Vol 5, No 4 (2014)

It can be difficult to provide unbiased assessment of demographic trends in large most populated countries because of the technological problems and political influences. Nevertheless, without understanding those unbiased tendencies it is impossible to assess and plan socio-economic activities of a state and its individual departments. It is important particularly for medical services strategic planning in which connection fundamental significance is attached to trends especially in pediatric population. According to the reports of the Federal State Statistics Service and of the Ministry of Health Care nowadays we see in Russia relatively favorable demographic tendencies together with steady growth of morbidity in population. These trends are differently directed in different regions and they are mostly inauspicious in rural sparsely populated areas of the northern European part of Russia, in the Urals, in Siberia and in the Far East where genetically deter-mined disorders are among factors that influence the quality of population. Deterioration in quality of growing population inevitably leads to increased costs of medical service. In order to plan medical services we need prognostic models with “population health status” used as dependent variable. In order to minimize the subjectivity while assessing the health status it can be described in terms of reliability theory particularly using the Gini index (1912), which is well known as a tool for risk assessment in mechanics and macroeconomics. In reliability theory. According to the fundamentals of the reliability theory systems are classified into deteriorating or improving, which respectively are defined as systems with increasing and decreasing Rate of OCcurrence Of Failures (ROCOF) or which is even more important for understanding of medical essence - respectively with short or long mean-time-between-failures. This interpretation corresponds to concepts of population morbidity and population ageing/rejuvenation. A Gini-type index (GTI) was introduced which needs one year data of mortality in age cohorts to reveal whether the population is ageing or rejuvenating. Negative values of GTI indicate rejuvenation (decreasing ROCOF), positive values indicate ageing (increasing ROCOF). The results of assessment of population ageing in Russia in 1959 an 2010 are presented. To calculate the GTI the database of Max Planck Institute for Demographic Research (Rostock, Germany) and University of California (Berkeley, USA) was used.

Cardiopulmonary resuscitation (CPR) with closed-chest cardiac massage was developed to maintain circulation and ventilation until life-threatening problems could be corrected or reversed. Studies on the effect of CPR have shown that about 80-95 % cases of resuscitation are fatal or severe neurological consequences and survival to discharge after CPR ranged from 6 to 22 % [2, 4, 8, 11]. Furthermore, the chances of survival decline rapidly if the resuscitation period more than 10 minute. At the same time, we know that successful neurologic outcomes are inversely associated with the time of brain hypoperfusion. Because of the low survival rate after prolonged CPR, more aggressive methods have been suggested to increase success. With the advancement of techniques, extracorporeal mechanical support has been applied in conjunction with CPR, with variable results [5, 12]. To assess the efficacy of resuscitation with extracorporeal membrane oxygenation was modeled the acute hypoxic cardiac arrest in pigs. Results of the study in the two groups demonstrate efficient switching method supporting circulatory support (ECMO) in the minutes of CPR. In the provision of an extended set of measures of cardiopulmonary resuscitation in the modeling of hypoxic cardiac arrest in animals in the group with ECMO received great survival to the end of the experiment, less expressed manifestations of acute heart failure. Intergroup comparison given the prerequisites for the development of protocols with the use of ECMO CPR, which would reduce the number of complications and death in patients undergoing cardiac surgery.

Hepcidin is a 25-amino acid peptide, which is a key systemic regulator of iron metabolism. As considered, overproduction of hepcidin in the liver is controlled by high levels of proinflammatory cytokines. Is it known that interleukin-6 play a key role in the development of anemia in patients with juvenile idiopathic arthritis (JIA). However, IL-6 blockers itself may provoke the onset of Macrophage Activation Syndrome (MAS), manifesting, particularly, also with anemia. In view of the fact that macrophages involved in MAS express CD163 - a scavenger receptor that binds hemoglobin-haptoglobin complexes - and activate the pathways which are important for adaptation to oxidative stress induced by free iron, we can consider hepcidin as a welcome challenge to predict the development of MAS early in the course of the disease. During the study of 35 patients with JIA treated with biological disease-modifying drugs (tocilizumab and golimumab), direct relations between the level of hemoglobin and hepcidin were not found. However, it was found that the mean corpuscular hemoglobin level is associated with hepcidin concentration in patients with JIA. It was found that concentration of serum hepcidin may be used for early differential diagnosis of anemia and MAS in patients with JIA. High probability of evolution of anemia to MAS was found when concentration of hepcidin was <140 ng/mL and ferritin >160 g/L. The following combinations were associated with high probability of evolution of slight anemia to a severe form, but not to MAS: 1. hepcidin >200 ng/mL and ferritin <140 g/L; 2. hepcidin >140 ng/mL and soluble transferrin receptor <1.6 mg/L; 3. hepcidin >140 ng/mL and total iron binding capacity >46 mcmol/L. Misclassification should be assessed during further studies.

It is suspected that the prevalence in different ethnic groups of HLA-genotype and of mutation CCR5delta32 - factors which alter adhesion of protein CCR5 - are the causes of different prevalence of juvenile idiopathic arthritis in different ethnic populations. Prerequisites to the fact that the mutation CCR5delta32 may have importance in determining susceptibility to the disease were the observations showing that CCR5 deletion polymorphism reveals a population and geographic diversity in addition to ethnic specificity. But reports on the role of gene deletion in the CCR5 chemokine receptor susceptibility to JIA rather contradictory. 234 DNA samples of patients with systemic JIA (soJIA) were ana-lyzed. The diagnosis was made according to the ILAR criteria. DNA was isolated using QIAamp Mini Kit (QIAGEN) according to the protocol provided. Our results didn’t reveal any differences in prevalence of mutation in patients with soJIA, in patients with soJIA + macrophage activation syndrome and in total population. Our results do not support the idea of protective role of the muta-tion CCR5delta32 against soJIA, which conclusion can be explained also by probable association of soJIA with HLA-genotype or other factors of ethnicity. At the same time, it can be considered as an additional evidence of expediency of soJIA being an original disease different from the rest of JIA group of diseases.

CCR5 delta 32 is a genetic variant of CCR5 - deletion mutation of a gene that has a specific impact on the adhesive function of T cells. It is believed that this mutation arose approximately two and a half thousand years ago and eventually spread in Europe. It has been hypothesized that this allele was favored by natural selection during the Black Death. In the heterozygotes, this mutation strongly reduces the chance of HIV infection In the homozygotes, it completely protects against HIV infection. CCR5 delta32 mutation in the heterozygous state occurs in Europe with a frequency of 5-14 %. The incidence of CCR5 delta32 outside of Europe is very low, and in many non-European ethnic groups it is completely absent. The prevalence of this mutation in the population of the Nenets has not previously investigated. It was assumed to have a lower frequency than in Europeans. We carried out an investigation with 54 blood samples of Nenets living in Yamalo-Nenets Autonomous District. DNA was extracted with was QIAamp DNA Mini Kit (QIAGEN) according to the manufacturer protocol. To identify the CCR5 delta32 deletion polymerase chain reaction was conducted using primers: CCR5-D32-F: 5`CTTCATTACACCTGCAGTC3`, CCR5-D32-R: 5`TGAAGATAAGCCTCACAGCC3` under the following conditions: 95˚-5’x1; 95˚-15” → 55˚-15” → 72˚-60”x40; 72˚-10’x1 → 4˚-∞. Products of the reaction were separated in 2 % aga-rose gel for 1.5 hours. Gel documentation was performed using a Gel Doc XR Plus (Bio-Rad, USA). The prevalence of CCR5 delta32 mutation in Nenets was found to be 9.3 %. This was a higher than expected frequency, and it corresponds to the average prevalence of CCR5 delta32 mutation in Europe. Our finding suggests possible European origin of the Nenets.

In order to assess the influence of course of pregnancy upon rate and rhythm of heartbeat of a baby in the early neonatal period of life, parameters of babies’ cardiac oscillators were described in terms of power spectral density function calculated for rows of 100-250 consecutive ECG RR-intervals registered during orthodox sleep. Correlation of heart rhythm characteristics, ECG patterns of a baby during first 5 days after delivery and parameters of pregnancy described both in terms of nosology and symptoms (122 parameters in total) were analyzed. 160 newborns were enrolled in the study. Drug abuse, impossi-bility to fill in the query form or informal consent, severe disease of baby, gestational age less than 28 weeks and/or body weight at birth less than 1500 grams were specified as major exclusion criteria. It was shown that preeclampsia during the first half of pregnancy and women’s illness, associated with body temperature higher than 38 degrees Celsius after 8 week of pregnancy are among major determinants of babies’ cardiac oscillator in the early neonatal period of life, but they don’t affect the ECG wave amplitude and the duration of PQ and QT intervals. Pregnancy complicated during the first half promotes bradycardia and high heart rate variability and pregnancy complicated during the second half promotes tachycardia and low heart rate variability in babies during at least 5 days after delivery. Hypothetical spatial models of pacemaker areas were proposed for cases of normal pregnancy, pregnancy complicated in the first half and pregnancy complicated in the second half.

The study of the immune status of immunopathological reactions and spectral sensitization in children with atopic dermatitis (215 children) and atopic bronchial asthma (197 children) aged 1 month to 17 years. The immune status was investigated by immunological tests of first level, subpopulations of lymphocytes by flow cytome-try, allergodiagnosis, diagnosis of autoimmune antibodies-enzyme-linked immunosorbent assay. Defined heterogeneity of immune system disorders, age-related features of sensitization to the household, food, epidermal and other allergens, the production of IgG autoantibodies to tissue antigens. The study of lymphocyte subpopulations indicates the presence of differences in the cellular immune re-sponse in children with atopic dermatitis and atopic asthma. The allergens that accumulate in the body have a direct effect on the functional activity of phagocytes. The study of the immune status in children with atopic allergic diseases it is necessary to conduct a reasonable individual pathogenic immune to improve the effectiveness of standard therapy, reduced the severity of the disease, frequency of exacerbations, and reduce the frequency and severity of comorbidity. Determination of specific IgE to a wide range of aller-gens, it is recommended to include in the scheme is mandatory labo-ratory examination of patients with atopic allergies. During the ex-amination and treatment of patients suffering from allergic diseases, it is necessary to consider the possibility of the presence of concomitant fungal sensitization. Measures to eliminate significant causal allergens should include correction of the child’s nutrition, control over the environment and the remediation of foci of chronic infection and normalization of the intestinal microflora. Immunore-habilitation children with allergopathology should be carried out taking into account the possible presence and activity of the auto-immune process.

The diagnosis and treatment of patients with hemodynamic disorders is basing of the understanding the physiology and pathophysiology of cardiovascular system. The relationship between length of muscle fibers and power reduction were first time revealed by Fick. Otto Frank was formulated fundamental principles of contractility of cardiomyocytes. Straub and Wiggers in 1914 was described the mail principles of the right ventricle work. Ernest Starling was performed a series of experiments, which explore a dependence of left ventricular ejection from venous inflow and elastic resistance of the aorta. In 1914 Ernest Starling was published research result, which describe how the mechanical energy of heart beats is depend from length fiber. Another essential part of knowledge of this problem was discovered by Aurtur Guyton experiments. Guyton has been established that there is a linear relationship between the pressure in the right atrium and the venous return. The lack of quantitative assessment of volume status has led to a qualitative approach, de-scribed by the term “response to the volume load.” However, as pointed out by some authors [16, 29], it is important to remember that the response to the preload is not a pathological condition. A quantitative approach to the assessment of volume status is based on the concept of Guyton on average system pressure filling, theoretically independent of cardiac function. This approach is used clinically. In this review article we describe possibility of clinical application of all knowledge of this questions.

Cardiovascular diseases are the major cause of death in neonates, children, adolescents and adults. Untreated congenital heart disease is the major cause of death worldwide in children younger than five years of age, exceeding the combined death rate caused, e.g. by malaria, tuberculosis or HIV [6]. In many developing countries, life expectancy is limited to an average of 58 to 64 years of age [1, 2]. In addition quality of life is markedly reduced while the number of disabled patients and patients depending from social welfare is steadily increasing. The major cause is undiagnosed and untreated cardiovascular diseases. Eighty percent of all cardiovascular deaths worldwide occur in developing countries [3]. Cardiology and cardiovascular surgery are powerful tools to increase the life expectancy, to improve and normalize the quality of life, to preserve patients able to work and to reduce the overall health care costs as well as costs for social welfare for those otherwise disabled by chronic cardiovascular diseases. Developing countries invest in cardiology and cardiovascular surgery. However, the establishment of a cardiovascular centre is a challenging task. The problem is that several specialties have to be developed simultaneously: cardiology, cardiac surgery, perfusion techniques, anaesthesia, intensive care as well as postoperative medical treatment - for adults and for children. The attractiveness of EurAsia Heart Foundation allowed establishing numerous international co-operations with excellent institutions, interested and engaged in teaching and education abroad.

For new tasks, in modern conditions must be prepared for lifelong learning, continuous improvement, retraining and self-education, professional mobility. Actuality the ideas contained in this article is to introduce new educational technologies and active learning at the Department of Human Anatomy. Virtual learning tools allow you to add in practical exercises, including anatomical dissection, extensive computer technology and optimize the learning process, contribute to a more depth study of anatomy. Application programs are recommended for independent work of students on the study of morphological and functional sections of human anatomy; self-correction and learning. The experience of resource use Primal Pictures in medical universities. This article describes a real possibility of integrated lessons in Anatomy and Informatics. From the standpoint of Fokine RR, when teaching Informatics advisable to convert your existing methods, forms and means of teaching in open learning system. Application of multilevel hierarchies based on the theory of open systems subject to adapt it to pedagogy will help develop methods of teaching computer science on the basis of which it is possible to build different models to optimize learning and teaching process. Instruction and work in such systems will promote the rise of and development of professional competency.