ThE uSE of AbErrAnT METhylATEd gEnES SEPT9 And VIM for clInIcAl dIAgnoSIS of colorEcTAl cAncEr

Cover Page

Abstract


Definition of epigenetic disorders is important for early diagnosis of colorectal cancer. To obtain a model of diagnostic test system with high sensitivity and specificity, we determined the frequency of methylation in SEPT9 and VIM genes. Epigenetic events also were compared with mutations in the RAS family genes. It was confirmed the presence of aberrant methylation in SEPT9 and VIM genes in tumor cells. DNA of tumor samples was significantly more methylated than samples with DNA from adjacent tissue (P = 8,67E-19 for SEPT9 gene and P=8,68E-19 for VIM gene). In the group of patients carried mutations in KRAS or NRAS genes tumor DNA significantly more methylated in gene SEPT9 (P = 0.0018), in contrast to the tumor DNA from patients not carried mutations. We have demonstrated that the combined use of methylation markers can improve the sensitivity of the test systems used in the diagnostics of colon cancer.

Колоректальный рак (КРР) является одним из наиболее агрессивных типов рака и зани- мает второе место по распространенности в Рос- сии. Было доказано, что одна из основных при- чин, влияющих на развитие этого заболевания, эпигенетические нарушения регуляции генов [1]. Определение эпигенетических нарушений имеет большое значение для ранней диагностики раковых заболеваний, так как нарушен- ная регуляция генов вследствие аберрантного метилирования ДНК является ключевой ста- дией в развитии опухоли [2]. При этом, метили- рованная ДНК является достаточно информа- тивным биомаркером и может быть легко изме- рена в образцах крови или плазмы [3]. Мети- лирование обширных регионов CpG-островков основное эпигенетическое изменение, харак- терное для процессов канцерогенеза при КРР. В настоящий момент на рынке представлены зарубежные коммерческие наборы для опреде- ления аберрантного метилирования генов SEPT9 либо VIM, однако эти наборы выпускаются раз- ными фирмами и применение в диагностичес- кой практике сразу двух генов затруднительно. Использование лишь одного маркера мети- лирования зачастую недостаточно для эффек- тивной диагностики заболевания, так как пока- затели чувствительности и специфичности отдельных маркеров невысоки, поэтому пред- ставляет интерес проверка диагностических характеристик модели из нескольких маркеров. Для этих целей мы определяли частоту метили- рования в генах SEPT9 и VIM. Наличие аберрантного метилирования в гене SEPT9 тесно связано с развитием КРР. Даже на ранних стадиях КР отмечается гиперметили- рование гена SEPT9 [1]. Септин принадлежит к классу ГТФ-связывающих полипептидов, кото- рые задействованы в большом количестве кле- точных процессов [4]. У людей в общей сложно- сти 13 генов септина. Все септины могут образо- вывать гетеромерные комплексы и участвуют в формировании структур наподобие нитей, колец и клеток. Эти уникальные структуры участвуют в клеточном делении, формируют плазму мем- браны, кольца сперматозоидов, основания рес- ничек и дендритов [5, 6]. Ген SEPT9 расположен на хромосоме 17q25.3, и экспрессируется в большинстве клеток чело- века. Было показано, что SEPT9 имеет 18 различ- ных транскриптов, которые кодируют 15 поли- пептидов [7]. Они играют важную роль в дина- мике актина, в процессах ангиогенеза, в подвиж- ности и пролиферации клеток, цитокинезе, регу- лировании микротрубочек, и процессах экзоци- тоза Несколько недавних исследований показы- вают, что SEPT9 занимает концевую позицию в октамерциссептиновом комплексе и играет клю- чевую роль в полимеризации субъединиц и ста- билизации целых гетеромеров [8]. Это также имеет важное значение для окончательного раз- деления дочерних клеток во время цитокинеза. Продукт гена VIM, виментин, входит в состав цитоскелета, а также задействован в иммунном ответе и контролирует транспорт липопротеинов низкой плотности. VIM содержит богатый CpG динулеотидами промотерный регион, рядом с которым расположен первый экзон, являю- щийся мишенью для ДНК-метилтрансфераз. Было показано, что в 53-84% образцов опу- холи и сыворотки больных КРР имеет место метилирование гена VIM [9, 10], таким образом, метилированный ген VIM является потенциаль- ным маркером для диагностики КРР. Важно отметить, что маркерные молекулы для диагностики заболеваний не всегда лежат в основе развития заболеваний. Данное утверждение в осо- бенности справедливо для маркеров метилирова- ния. В ряде работ было показано отсутствие пря- мой корреляции между аберрантным метилирова- нием и выраженностью экспрессии генов [11, 12]. При анализе генома пациентов с КРР очень часто выявляются мутации (частота до 40%) [13]. KRAS является геном, кодирующим один из бел- ков, играющих важную роль в сигнальной системе рецептора эпидермального фактора роста (EGFR) - сложного сигнального каскада, принимающего участие в развитии и прогрессировании рака. Белок KRAS регулирует другие белки, находящи- еся далее в сигнальной системе EGFR, которые связаны с выживаемостью опухоли, ангиогенезом, пролиферацией и метастазированием [14]. При метастатическом колоректальном раке почти 60% пациентов имеют нормальную сиг- нальную систему EGFR и дикий тип гена KRAS; остальные 40% имеют мутантный тип гена [13]. Тестирование генов, кодирующих белки семейства RAS (K-RAS и N-RAS) позволяет отобрать пациентов с диким типом (без мута- ции) генов RAS, у которых может быть получен ответ при лечении моноклональными антителами, блокирующими EGFR. В данном исследовании мы обладали воз- можностью сопоставить статус мутации генов семейства RAS с наличием аберрантного мети- лирования в выбранных нами генах. Основной задачей этой работы был анализ метилирования промотерных участков генов SEPT9 и VIM у пациентов с КРР для формирова- ния единой панели эпигенетических маркеров, позволяющей диагностировать данную онкопа- тию с высокой чувствительностью и специфич- ностью. Материалы и методы Работа была одобрена локальным этическим комитетом, выполнена в соответствии с требо- ваниями GCP (Good Clinical Practice) и Хель- синской декларацией по защите прав человека. Исследование включало 150 парных образ- цов опухолевой ткани с известным статусом мутации генов семейства RAS и прилегающей гистологически неизмененной ткани пациентов с аденокарциномой прямой кишки, прохо- дивших лечение в Республиканском клиниче- ском онкологическом диспансере Министер- ства здравоохранения Республики Татарстан в 2008-2012 годах (таблица 1). Каждый паци- ент подписал добровольное информированное согласие на участие в проведении исследования. Опухоли классифицированы в соответствии с TNM-классификацией Международного про- тиворакового союза и описаны гистологически на основании классификации Всемирной Орга- низации Здравоохранения (ВОЗ) [12, 13]. Для отбора образцов с высоким содержанием опу- холевых клеток проводили дополнительный гистологический анализ микросрезов. Отби- рали образцы из первичных очагов с содержа- нием опухолевых клеток не менее 50%. Таблица 1 Клиническая характеристика пациентов Пол Количество мужской 72 женский 78 Возраст >50 124 <50 26 Стадия опухоли Т2M0 11 Т3M0 36 Т4М0 38 Т2М1 2 Т3М1 18 Т4М1 28 Выделение ДНК осуществлялось набо- ром QIAamp DNA FFPE Tissue Kit («Qiagen», Германия), концентрацию суммарной ДНК в водном растворе оценивали на спектрофотоме- тре NanoVue Plus («GE Healthcare», Великобри- тания) по соотношению оптической плотности при длинах волн 260 и 280 нм. Бисульфитная кон- версия и очистка проводились наборами EpiTect Fast Bisulfite Conversion Kit («Qiagen», Герма- ния) с помощью автоматической станции пробо- подготовки QIAcube («Qiagen», Германия). Изу- чение профилей метилирования производилось с помощью метода MethyLight PCR c олигонукле- отидами (таблица 2), подобранными на локусы, содержащие дифференциально метилируемые CpG-островки, на приборе StepOnePlus™ Real- Time PCR Systems («Applied Biosystems», США). В качестве неметилированного гена сравнения использовали COL2A1. Для определения степени метилирования вычисляли величину порогового цикла (Ct) для каждого гена-мишени, затем вели- чину ΔCT (мишень-контроль), после значение ΔΔCT (мишень-калибрант). Величина RQ рас- считывалась по формуле RQ=2^(- ΔΔCT). Мети- лированным считался образец с RQ>10. Статус мутаций в генах KRAS и NRAS опре- деляли с помощью наборов KRAS-24 и NRAS-24 (ООО «Тестген», Россия). Статистический анализ данных проводили с применением точного критерия Фишера. Уро- вень значимости принят равным 0.05. Конкор- дантность данных по метилированию оцени- вали с помощью непараметрической ранговой корреляции Спирмана. Значимость корреляции по Спирману (Rs) проверяли с помощью t-теста Стьюдента: с числом степеней свободы ν = N - 2, где N - размер выборки. Уровень значимости принят равным 10-6. Чувствительность и специфичность мар- керов оценивались с помощью ROC-анализа (MedCalc.2 software) Результаты и обсуждение В данном исследовании подтвердилось нали- чие аберрантного метилирования у пациентов, больных КРР. ДНК образцов опухоли была досто- верно чаще метилирована, чем ДНК образцов прилежащей ткани (P=8,67E-19 для гена SEPT9 и P=8,68E-19 для гена VIM) (рис. 1). Довольно интересно, что гены SEPT9 и VIM не являются биологически значимыми маркерами в разви- тии КРР, однако ценность их как диагностиче- ских маркеров представляется нам очень высокой, так как в отличие от таких маркеров, как MLH1 и MGMT (продукты которых участвуют в канце- рогенезе), они обладают высокими показателями как чувствительности, так и специфичности (чув- ствительность 60-70% для SEPT9 и VIM) По результатам проведенной работы мы выя- вили, что в группе пациентов, имеющих мута- ции в генах KRAS или NRAS, ДНК опухоле- вых образцов достоверно чаще метилирована в генe SEPT9 (P=0.0018), в отличие от ДНК опу- холевых образцов пациентов, не несущих дан- ных мутаций. В исследованиях похожей тема- тики также подтверждается частое гипермети- лированние промотерных участков генов при наличии активирующих мутаций гена KRAS [15]. Биологические основы этого обстоятель- ства на сегодняшний день до конца не изучены. Мы можем предположить, что процессы канце- рогенеза у носителей мутаций в генах семейства Параметры праймеров и зондов для ПЦР в режиме реального времени Таблица 2 Ген Последовательность, 5’-3’ Длина продукта Условия реакции, °С SEPT9 Праймер - FM, TAGGGTTCGGGTTTCGTCG ,57C Праймер - RM,TTTCAAAACTTCGAAATCCG,51C Зонд - CGCGTTAACCGCGAAATCCG-BHQ1, 61C 98 51 VIM Праймер - FM, GGCGGTTCGGGTATCG,56C Праймер - RM, CGTAATCACGTAACTCCGACT,54C Зонд - GACGCGGAGGCGAGTCGGTCG-BHQ1, 63C 146 54 COL2A1 Праймер - FM, AGGGTAATTTTGGAATAGATGGA, 64C Праймер - RM, TCTCCTAAAATAACAAAATCCACAA, 63CЗонд - CAACACTCACAACAAATCCTTTAACTCCAA -BHQ2, 69C 83 54 RAS протекают в целом быстрее и агрессивнее [16, 17], поэтому аберрантное метилирование в некоторых генах у пациентов-носителей мута- ций также будет выражено сильнее. Рис. 1. Процент метилированных образцов в зависимости от статуса мутации генов,кодирующих белки семейства RAS. Мы провели корреляционный анализ для выявления зависимости степени прогрессирова- ния КРР (учитывалось наличие или отсутствие метастазов) и частоты метилирования. Корре- ляция между данными показателями оказалась очень слабой (r=0,03967, P>0,05 для гена SEPT9, r= 08871, P>0,05 для гена VIM). Вероятно, для выявления степени прогрессирования КРР сле- дует анализировать профиль метилирования. На сегодняшний день для диагностики коло- ректального рака существуют наборы для опре- деления метилирования в гене SEPT9, либо набор для определения метилирования в гене VIM, однако обеспечить лишь одним из данных наборов необходимые для диагностики показа- тели чувствительности и специфичности пред- ставляется затруднительным. Использование нескольких маркеров позволили бы улучшить показатели диагностических тест-систем. В рамках данной работы был рассчитан индекс метилирования для каждого образца и проверены параметры чувствительности и специфичности как для совокупности маркеров, так и для каж- дого маркера в отдельности. За пороговое значе- ние для анализа совокупности маркеров был взят индекс метилирования, равный 0,5. Под индек- сом метилирования понимается отношение числа метилированных локусов к общему числу локу- сов модели. При этом значении система из марке- ров имеет высокие показатели чувствительности и специфичности (91,3% и 78,0% соответственно). AUC, показатель интегральной оценки качества и предсказательной способности модели, состав- ляет 0,90, что говорит о высоком качестве модели. Таким образом, использование нескольких маркеров при диагностике КРР позволяет существенно улучшить параметры тест-системы. Выводы В данной работе подтверждается высокая частота метилирования генов SEPT9 и VIM в опухолевых тканях больных КРР. Для генов SEPT9 и VIM были установлены высокие показатели чувствительности и специ- фичности (чувствительность 70,7% и специфич- ность 89,4 % для SEPT9, чувствительность 75,3% и специфичность 87,3% для VIM), которые счита- ются важными клиническими маркерами, имею- щими большие перспективы в диагностике КРР. В настоящем исследовании мы показали, что Рис. 2. Сравнение результатов ROC-анализа для каждого маркера в отдельности и для совокупности маркеров. ДНК опухолевых образцов пациентов с мутаци- ями в гене KRAS достоверно чаще метилирована в гене SEPT9 (P=0.0018) в отличие от ДНК опу- холевых образцов пациентов, не несущих данных мутаций. Однако биологические основы этих результатов требуют дальнейших изучений. Нами было продемонстрировано, что исполь- зование совокупности маркеров метилирования, таких как SEPT9 и VIM, позволяет улучшить чув- ствительность тест-систем, используемых в диа- гностике КРР, но показатели специфичности остаются на прежнем уровне. В связи с получен- ными результатами нами планируется проверить эффективность таких маркеров метилирования, как APC, ITGA4, RASSF1A, а также оценить пока- затели системы, состоящей из пяти маркеров. Таким образом, внедрение в практику теста, основанного на определении маркеров КРР, может сократить время и облегчить процедуру диагностики данного заболевания, а также слу- жить хорошим средством для оценки динамики состояния пациентов.

O I Brovkina

Email: brov.olia@gmail.com

M G Gordiev

Email: marat7925@gmail.com

D S Khodyrev

Email: DmKh008@gmail.com

A G Nikitin

Email: avialn@gmail.com

A V Averyanov

Email: averyanovav@mail.ru

  1. Jones P.A., Baylin S.B. 2007. The Epigenomics of Cancer. Cell. 2007;128: 683-692.
  2. Wild N., Andres H., Rollinger W., et al. A combination of serum markers for the early detection of colorectal cancer. Clin Cancer Res. 2010;16(24):6111-21. doi: 10.1158/1078-0432.CCR-10-0119.
  3. Leon S.A., Shapiro B., Sklaroff D.M., Yaros M.J. Free DNA in the serum of cancer patients and the effect of therapy. Cancer Res. 1977;37: 646-650.
  4. Russell S.E.H., Hall P.A. Do septins have a role in cancer? Br. J. Cancer. 2005;93: 499-503.
  5. Kinoshita M., Noda M. Roles of septins in the mammalian cytokinesis machinery. Cell Struct Funct. 2001;26: 667-670.
  6. Joo E., Tsang C.W., Trimble W.S. Septins: traffic control at the cytokinesis intersection. Traffic Cph. Den. 2005;6: 626-634.
  7. McDade S.S., Hall P.A., Russell S.E.H. Translational control of SEPT9 isoforms is perturbed in disease. Hum Mol Genet. 2007;16: 742-752.
  8. Estey M.P., Di Ciano-Oliveira C., Froese C.D., Bejide M.T., Trimble W.S. Distinct roles of septins in cytokinesis: SEPT9 mediates midbody abscission. J Cell Biol. 2010;191: 741-749.
  9. Zou H., Harrington J.J., Shire A.M., et al. Highly methylated genes in colorectal neoplasia: implications for screening. Cancer Epidemiol Biomarkers Prev. 2007 Dec;16(12):2686-96.
  10. Brenner D.E., Rennert G. Fecal DNA biomarkers for the detection of colorectal neoplasia: attractive, but is it feasible? J Natl Cancer Inst. 2005; 97: 1107-9.
  11. Schneider K.U., Dietrich D., Fleischhacker M., et al. Correlation of SHOX2 Gene Amplification and DNA Methylation in Lung Cancer Tumors. BMC Cancer. 2011 Mar 22;11:102. doi: 10.1186/1471-2407-11-102.
  12. Mikeska T., Craig J.M. DNA Methylation Bio-markers: Cancer and Beyond. Genes. 2014;5:821-864.
  13. Linardou H., Briasoulis E., Dahabreh I.J., et al. 2011. All about KRAS for clinical oncology practice: gene profile, clinical implications and laboratory recommendations for somatic mutational testing in colorectal cancer. Cancer Treat. Rev. 2011;37: 221-233.
  14. Ying H.-Q., Wang F., He B.-S., et al. The involvement of Kras gene 3’-UTR polymorphisms in risk of cancer and influence on patient response to anti-EGFR therapy in metastatic colorectal cancer: a meta-analysis. OncoTargets Ther. 2014;7: 1487-1496.
  15. Кит О.И., Водолажский Д.И., Дваденко К.В., et al. 2016. Аберрантное метилирование промоторных участков генов APC, CDH13 и MGMT у больных колоректальным раком. Сибирский Онкологический Журнал. 2016;15: 48-55.
  16. Cerottini J.P., Caplin S., Saraga E., Givel J.C., Benhattar J. The type of K-ras mutation determines prognosis in colorectal cancer. Am J Surg. 1998;175: 198-202.
  17. Беляева А.В. Мутации в гене K-RAS у больных колоректальным раком. Автореф. дис. ...канд. мед. наук. Спб.: 2012.- 27 с.

Views

Abstract - 208

PDF (Russian) - 157

Cited-By


PlumX


Copyright (c) 2016 Brovkina O.I., Gordiev M.G., Khodyrev D.S., Nikitin A.G., Averyanov A.V.

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License.