ANALYSIS OF GENE METHYLATION SHOX2, TGFBR1, MIR-375 IN DIFFERENT TYPES OF LUNG CANCER

Cover Page

Abstract


In the 21st century is an acute problem to find effective and inexpensive methods for the early detection of lung cancer. Patients suspected of having a malignant disease of the lungs, generally undergo clinical studies such as CT scans of the chest and bronchoscopy. The latter is mainly used to confirm the diagnosis. However, even when the signs, symptoms and radiological findings indicate that clinical diagnosis of malignant lung disease is evident, additional invasive procedures for obtaining the biological material suitable for the final confirmation of the presence of malignant cells. Currently, there is a clear understanding of the need to find biomarkers able to detect pre-clinical stage of cancer cells using minimally invasive procedures. In this paper, for the DNA of patients with different types of lung cancer samples, with a view to a better understanding of the causes of lung cancer pathology gene methylation analysis was conducted for SHOX2, TGFBR1 and MIR-375.

Введение Метилирование ДНК является важным эпи- генетическим процессом, играющим огромную роль в фундаментальных биологических событиях, таких, как развитие и дифференцировка клеток [1]. Нарушение этого процесса играет важную роль в канцерогенезе [2], а аберрант- ное метилирование ДНК является отличительной чертой возникновения рака у человека. [3, 4]. В настоящее время анализ метилирования ДНК является ценным источником при поиске биомаркеров рака [5]. Маркеры на основе мети- лирования ДНК представляют большой инте- рес в тех случаях, когда трудно поставить диа- гноз, используя обычные диагностические про- цедуры. Кроме того, материал для исследова- ния маркеров метилирования может быть полу- чен малоинвазивными способами. В то же время профили метилирования ДНК в значительной степени отличаются в различных типах раковых клеток и могут быть использованы для установ- ления типа опухоли и определения лекарствен- ной чувствительности. Недавно был обнаружен ценный биомаркер, основанный на метилировании гена SHOX2, для выявления рака легких в бронхиальных аспи- ратах. [6]. Ген SHOX2 является членом семей- ства гомеобоксных генов, кодирующих белки, содержащих мотив из 60-аминокислотных остатков, который представляет собой ДНК- связывающий домен. Гомеобоксные гены были широко охарактеризованы как транскрипцион- ные регуляторы. Увеличение числа копий гена SHOX2 было признано одним из самых распро- страненных и значимых хромосомных пере- строек при раке легкого [7-11]. В то же время, ненормальное метилирование гена SHOX2 является отличительной чертой раковых опухо- лей легких и коррелирует с увеличением числа копий участка локуса 3q25.3 [12, 13]. Метилирование гена SHOX2 обнаруживается при злокачественной трансформации легких даже у пациентов с отрицательным результатом по цитогистологии [14, 15]. Стоит отметить, что метилирование гена SHOX2 наблюдается в раз- личных гистологических подтипах рака легких [12, 14-16], с особенно высокой частотой при мелкоклеточном и плоскоклеточном раке лег- кого [16]. Однако, в настоящее время не хватает информации о молекулярном механизме регу- лирования SHOX2. SHOX2 действуя как транскрипционный фактор: повышает активность экспрессии транс- формирующего фактора роста β-рецептора I (TβR-I). [17]. В течение последнего десятилетия tgf-β-сигнальный путь является одним из глав- ных путей развития рака из-за его способности регулировать клеточный рост и дифференци- ровку. Различные члены суперсемейства tgf-β часто мутируют при раке [18, 19]. В нормальных клетках ТФР-β действует как супрессор опухоли, ингибируя рост клеток, способствуя кле- точной дифференцировке, и/или индуцируя апоптоз. Однако, в ходе поэтапного перехода от предраковых злокачественных клеток, ТФР-β утратил ингибирующие свойства из-за потери функциональных рецепторов и внутриклеточ- ных мессенджеров в tgf-β-сигнальном пути [20, 21]. Предполагается, что метилирование про- мотора компонентов суперсемейства tgf-β явля- ется одним из основных способов инактивации ТФР-β сигнального пути [22, 23]. С другой стороны, было показано, что SHOX2 является мишенью mir-375 при эпителиально- мезенхимальном переходе в клетках рака молоч- ной железы [17]. Ранее сообщалось, что метили- рование микроРНК mir-375 при немелкокле- точном раке легкого достаточно частое событие [24]. Материалы и методы Образцы опухолей и гистологически нормаль- ной ткани легкого от 187 пациентов (характе- ристики образцов даны в табл.1), которые под- писали информированное согласие на прове- дение исследования и до операции не получав- шие лучевую или химиотерапию, были собраны и клинически охарактеризованы в Республи- канском клиническом онкологическом диспан- сере Министерства здравоохранения Респу- блики Татарстан (г. Казань) в 2014-2016 гг. Опухоли классифицированы в соответствии с TNM-классифкацией Международного проти- воракового союза и описаны гистологически на основании классификации Всемирной Организа- ции Здравоохранения (ВОЗ) [25, 26]. Для отбора образцов с высоким содержанием опухолевых клеток проводили дополнительный гистологи- ческий анализ микросрезов (толщина 3-5 мкм), окрашенных эозином и гематоксилином. Отби- рали образцы с содержанием опухолевых клеток не менее 70%. Образцы тканей хранили при -70°С. Выделение ДНК. Геномную ДНК из легоч- ной ткани пациентов выделяли на автоматичес- кой станции QIAcube по протоколу Blood and body fluid spin protocol V3. Контроль количества и качества ДНК осуществляли с помощью спектрофотометра NanoVue Plus (GE Healthcare). Бисульфитная конверсия. Бисульфит- ную конверсию ДНК осуществляли с помощью набора EpiTect Fast DNA Bisulfite Kit по прото- колу Quick-StartProtocol. Очистку после кон- версии проводили на автоматической стан- ции QIAcube по протоколу Cleanup of 100 ng or more bisulfite converted DNA. В качестве контролей использовали геномную ДНК Jurkat (НПО «СибЭнзим») обработанную CpG-метилазой M.Sss I и геномную ДНК L-68 (НПО «СибЭн- зим»). РТ-ПЦР. Амплификацию промотерных областей исследуемых генов проводили с помо- щью ПЦР «в реальном времени» на термоци- клере “ABI StepOnePlus” (Applied Biosystems). Олигонуклеотидные праймеры синтезированы ЗАО «Евроген», г. Москва, флуоресцентные зонды синтезированы ООО «ДНК-Синтез», г. Москва). Условия амплификации фрагмен- тов ДНК: 950C/2 мин - 1-й цикл; 940C/10 сек, 58-660C/60сек - 40 циклов, условия ПЦР, последовательности праймеров, флуоресцент- ных зондов приведены в табл. 2. Статистический анализ проводили с применением точного критерия Фишера. Уровень значимости принят равным 0.05. Расчеты про- водили с помощью программы для статистичес- кого анализа данных STATISTICA 10. Результаты и обсуждения При изучении метилирования использовался метод RQ анализа, который позволяет провести достаточно точное сравнение уровня метили- рования матрицы в каждом образце. В качестве эндогенного контроля использовался ген COMT. В качестве калибратора геномная ДНК Jurkat, обработанная метилтрансферазой M.SssI. Для расчета значений RQ использовалось программ- ное обеспечение фирмы Applied Biosystems. На рисунках 1 и 2 приведены результы ана- лиза метилирования для генов SHOX2, Mir-375 и TGFBR1 в образцах ткани пациентов с различ- Популяционные характеристики пациентов Таблица 1 Общее кол-во образцов Опухоль Условная норма* 185 (100%) 164 (100%) 21 (100%) Возраст До 50 лет 25 (16%) 25 (15%) 5 (24%) После 50 лет 139 (84%) 139 (85%) 16 (76%) Пол Мужской 104 (64%) 104 (63%) 15 (71%) Женский 60 (36%) 60 (37%) 6 (29%) Гистологический тип Аденокарцинома(АД) - 126 (77%) - Плоскоклеточный раклегкого (ПРЛ) - 24 (15%) - Мелкоклеточный рак легкого (МРЛ) - 14 (8%) - Стадия I - 2 (1%) - II - 159 (97%) - III - 1 (1%) - IV - 2 (1%) - Метастазы No - 18 (11%) - Nx - 146 (89%) - Метастазы Mo - 156 (95%) - Mx - 8 (5%) - Степень дифференцировки Низкая - 13 (8%) - Умеренная - 30 (19%) - Высокая - 4 (2%) н/д - 117 (71%) - * Образцы гистологически нормальной ткани, прилежащей к опухоли. Последовательности праймеров, зондов и условия амплификации Таблица 2 Ген Последовательность праймеров Тотж, 0С/ Размер продукта, п.о. SHOX2 Прямой, CAAACCCCGATATTATACCGОбратный, TCGTGCGATTTCGGTCGЗонд, FAM- CGCATCCGCAAACGCCCCTCG -BHQ1 Блокатор 1: ATTATACCACACAAAAAACCA-PБлокатор 2: ATTTTGGTTGGGTAGGTG-P 60/132 Mir-375 Прямой, TCGGGATAAGTTTTAAGGCОбратный, ATCTACGACTAACACGTCGЗонд, FAM-GCGACGACCACCGCAAATACGCACCTA-BHQ1 60/160 TGFBR1 Прямой, AGTTATAAAGGGTCGGAGCОбратный, CGAAAACGCGAAACAACGЗонд, FAM-CCGCCGCCACCGCCTATAACCCGA-BHQ1 60/155 COMT Прямой, GGGATAGTGTTATTGGTTGAОбратный, CTACCTAAACCCTTATAAATAACCЗонд, FAM-TGGAATATAGGGAGGTGGTGGA-BHQ1 60/164 ными типами рака легкого. Как можно видеть, метилирование гена SHOX2 является более частым событием при ПРЛ (79%) и МРЛ (71%) нежели АД (43%) (рис.1), что согласуется с данными других авто- ров [16]. Напротив, для гена Mir-375 метилиро- вание выявляется в 8% при ПРЛ, 7% при МРЛ и 6 % при АД. Сообщалось, что Mir-375 пода- вляет экспрессию SHOX2 в клетках рака молоч- ной железы [27]. Как можно видеть на рисунке 1В, из 7 образцов, в которых обнаруживается метилирование Mir-375, четыре не обнаружи- вают метилирования SHOX2. Для ПРЛ и МРЛ такие случаи отсутствуют. Это может указывать на разные механизмы при возникновении онко- патологии легких. В нормальных клетках TGFBR1 действует как опухолевый супрессор [27]. Метилирование гена TGFBR1 играет важную роль при возникно- вении таких онкопатологий как плоскоклеточ- ный рак пищевода [28] и рак желудка [29]. Мы Рис. 1. Данные по метилированию для генов SHOX2, Mir-375 и TGFBR1 в образцах ткани пациентов с плоскоклеточным (А), мелкоклеточным нейроэндокринным (Б) и аденокацино- мой (В) легкого. Рис. 2. Результаты анализа метилирования для генов SHOX2, Mir-375 и TGFBR1 в образцах ткани пациентов с плоскоклеточным (ПРЛ), мелкоклеточным нейроэндокринным (МРЛ) и аденокациномой (АД) легкого. Рис. 3. Зависимость метилирования гена SHOX2 с полом пациентов. показали, что метилирование TGFBR1 при раке легкого является довольно редким событием и обнаруживается в 7% случаев только при АД. Для ПРЛ и МРЛ отсутствие метилирования может объясняться малой выборкой образцов. С другой стороны, SHOX2 транскрипционно регу- лирует экспрессию TGFBR1 [17] и частое мети- лирование SHOX2 может приводить к сниже- нию экспрессии TGFBR1, что дает преимуще- ство раковым клеткам в росте. Стоит заметить, что исследуемая выборка образцов состоит пре- имущественно из образцов II стадии (табл.1), это может указывать на то, что снижение экс- прессии TGFBR1 является одним из ранних эта- пов при возникновении рака легкого. Сообща- лось, что при плоскоклеточном раке пищевода метилирование гена TGFBR1 чаще отмечалось на стадии III и IV, чем на стадии I и II [28]. Для образцов условно нормальной ткани лег- кого метилирование генов SHOX2, TGFBR1 и miR- 375 обнаружено не было (данные не приведены). Исследованы возможные корреляции между частотами метилирования генов и клинико- гистологическими характеристиками образ- цов пациентов. Статистически значимая кор- реляция с полом пациентов выявлена для гена SHOX2 (рис. 3). Заключение Полученные в данной результаты добавляют ясности в причины возникновения онкопатоло- гии легких. Обнаруженная связь метилирова- ния SHOX2 c полом пациентов требует более глубокого анализа. Кроме того, результаты дан- ной работы могут найти применение при ранней диагностике рака легких.

D S Khodyrev

Email: DmKh008@gmail.com

N S Kulagina

Email: nskulagina@gmail.com

O I Brovkina

Email: brov.olia@gmail.com

V E Pokrovsky

Email: vasiliy.pokrovsky@gmail.com

M G Gordiev

Email: marat7925@gmail.com

A S Кelekhsaeva

A G Nikitin

Email: avialn@gmail.com

A V Averyanov

Email: averyanovav@mail.ru

  1. Robertson K.D. DNA methylation and human disease. Nat Rev Genet 2005; 6: 597-610.
  2. Ting A.H., McGarvey K.M., Baylin S.B. The cancer epigenome-components and functional correlates. Genes Dev 2006; 20: 3215-3231.
  3. Shen H., Laird P.W. Interplay between the cancer genome and epigenome. Cell 2013; 153: 38-55.
  4. Suva` M.L., Riggi N., Bernstein B.E. Epigenetic reprogramming in cancer. Science 2013; 339: 1567-1570.
  5. Laird P.W. The power and the promise of DNA methylation markers. Nat Rev Cancer 2003; 3: 253-266.
  6. Schmidt B., Liebenberg V., Dietrich D., et. al. SHOX2 DNA methylation is a biomarker for the diagnosis of lung cancer based on bronchial aspirates. BMC Cancer 2010; 10: 600.
  7. Qian J., Massion P.P. Role of chromosome 3q amplification in lung cancer. J Thorac Oncol 2008; 3: 212-215.
  8. Shen H., Gao W., Wu Y.J., et. al. Multicolor fluorescence in situ hybridization and comparative genomic hybridization reveal molecular events in lung adenocarcinomas and squamous cell lung carcinomas. Biomed Pharmacother 2009; 63: 396-403.
  9. Dehan E., Ben-Dor A., Liao W., et. al. Chromosomal aberrations and gene expression profiles in non-small cell lung cancer. Lung Cancer 2007; 56: 175-184.
  10. Yen C.C., Liang S.C., Jong Y.J., et. al. Chromosomal aberrations of malignant pleural effusions of lung adenocarcinoma: different cytogenetic changes are correlated with genders and smoking habits. Lung Cancer 2007; 57: 292-301.
  11. Huang Y.T., Heist R.S., Chirieac L.R., et. al. Genome-wide analysis of survival in early-stage non- small-cell lung cancer. J Clin Oncol 2009; 27: 2660-2667.
  12. Dietrich D., Hasinger O., Liebenberg V., et. al. DNA methylation of the homeobox genes PITX2 and SHOX2 predicts outcome in non-small-cell lung cancer patients. Diagn Mol Pathol 2012; 21: 93-104.
  13. Schneider K.U., Dietrich D., Fleischhacker M., et. al. Correlation of SHOX2 gene amplification and DNA methylation in lung cancer tumors. BMC Cancer 2011; 11: 102.
  14. Schmidt B., Liebenberg V., Dietrich D., et. al. SHOX2 DNA methylation is a biomarker for the diagnosis of lung cancer based on bronchial aspirates. BMC Cancer 2010; 10: 600.
  15. Dietrich D., Kneip C., Raji O., et. al. Performance evaluation of the DNA methylation biomarker SHOX2 for the aid in diagnosis of lung cancer based on the analysis of bronchial aspirates. Int J Oncol 2012; 40: 825-832.
  16. Kneip C., Schmidt B., Seegebarth A., et. al. SHOX2 DNA methylation is a biomarker for the diagnosis of lung cancer in plasma. J Thorac Oncol 2011; 6: 1632-1638.
  17. Hong S., Noh H., Teng Y., et. al. SHOX2 Is a Direct miR-375 Target and a Novel Epithelial-to-Mesenchymal Transition Inducer in Breast Cancer Cells Neoplasia 2014; 16(4): 279-290.
  18. Shelling A.N. Mutations in inhibin and activin genes associated with human disease. Mol Cell Endocrinol 2012; 359(1-2): 113-120.
  19. Akhurst R.J., Hata A. Targeting the TGFβ signalling pathway in disease. Nat Rev Drug Discov 2012; 11(10): 790-811.
  20. Bottinger E.P., Jakubczak J.L., Roberts I.S., et al. Expression of a dominant-negative mutant TGF-beta type II receptor in transgenic mice reveals essential roles for TGF-beta in regulation of growth and differentiation in the exocrine pancreas. EMBO J. 1997; 16(10): 2621-33.
  21. Amendt C., Schirmacher P., Weber H., et. al. Expression of a dominant negative type ii tgf-beta receptor in mouse skin results in an increase in carcinoma incidence and an acceleration of carcinoma evelopment. Oncogene 1998; 17(1): 25-34.
  22. Ammanamanchi S., Brattain M.G. Restoration of transforming growth factor-{beta} signaling through receptor RI induction by histone deacetylase activity inhibition in breast cancer cells. J Biol Chem. 2004; 279(31): 32620-32625.
  23. Osada H., Tatematsu Y., Masuda A., et al. Heterogeneous transforming growth factor (TGF)-β unresponsiveness and loss of TGF-β receptor type II expression caused by histone deacetylation in lung cancer cell lines. Cancer Res. 2001; 61(22): 8331-8339.
  24. Rykov S.V., Khodyrev D.S., Pronina I.V., et. al. Novel miRNA genes methylated in lung tumors. Genetika 2013; 49(7): 896-901.
  25. Sobin L.H., Gospodarowicz M.K., Wittekind Ch. Eds. TNM Classification of Malignant Tumors, 7th ed. Wiley-Blackwell, Oxford 2009; 310 pgs.
  26. Travis W.D., Coby T.V., Corrin B., et. al. World Health Organization International Histological Classification of Tumours; histological typing of lung and pleural tumours. Springer 1999.
  27. Pasche B., Pennison M. J., Jimenez H., et. al. Transactions of the american clinical and climatological association 2014; 125.
  28. Dong Z., Guo W., Guo Y. et. al. Concordant promoter methylation of transforming growth factor-beta receptor types I and II occurs early in esophageal squamous cell carcinoma. Am J Med Sci. 2012; 343(5): 375-381.
  29. Guo W., Dong Z., Guo Y., et. al. Concordant repression and aberrant methylation of transforming growth factor-beta signaling pathway genes occurs early in gastric cardia adenocarcinoma. Mol Biol Rep. 2012; 39(10): 9453-9462.

Views

Abstract - 117

PDF (Russian) - 112

PlumX


Copyright (c) 2016 Khodyrev D.S., Kulagina N.S., Brovkina O.I., Pokrovsky V.E., Gordiev M.G., Кelekhsaeva A.S., Nikitin A.G., Averyanov A.V.

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License.