THE ROLE OF ABERRANT METHYLATED IN GENES APC, RASSF1A AND ITGA4 FOR DIAGNOSIS OF COLORECTAL CANCER

Abstract

The “gold standard” of diagnosis of colorectal cancer (CRC) is a colonoscopy. Despite the high reliability, this method is not applicable in large-scale population screening or in estimation of the disease dynamics in a particular patient. In this study, we conducted an investigation of aberrant methylation in the APC, RASSF1A and ITGA4 genes. The study included 150 pairs of tumor tissue samples with known mutation status of the RAS family genes and the surrounding histologically unchanged tissue of patients with rectal adenocarcinoma treated at the Republican Clinical Oncology Dispensary of the Ministry of Health of the Republic of Tatarstan. The methylation profiles were studied using MethyLight PCR. The most difference in the methylation between tumor and healthy tissue was observed for the ITGA4 gene (sensitivity 78%, specificity 92.7%). For the APC gene sensitivity was 32%, specificity -93.3%, for the RASSF1 gene sensitivity was 85.3%, specificity - 56.7%. Previous data on the aberrant methylation of the SEPT9 and VIM genes and new data on the APC, RASSF1A and ITGA4 genes were compared with the mutations status in the KRAS and NRAS genes. The DNA of tumor samples was significantly more often methylated in the SEPT9 (P= 0.0018) and ITGA4 (P = 0.0044) genes in the group of patients carrying mutations in the KRAS or NRAS genes, in contrast to the DNA of tumor samples of non-carriers. In statistical analysis of the effectiveness of the diagnostic test system, it was shown that our model, which includes five methylation markers (APC, RASSF1A, ITGA4, SEPT9 and VIM), has the best sensitivity and specificity (82.7% and 97.3%, respectively). The obtained model of the diagnostic test system is proposed to be used for diagnostic problems.

Full Text

Введение Колоректальный рак (КРР) является одной из основных причин заболеваемости раком и смертности во всем мире [1]. В России КРР занимает второе место по распространенности среди онкологических заболеваний [2]. «Золотым стандартом» диагностики КРР является колоноскопия - эндоскопическое исследование толстой кишки и терминального отдела подвздошной кишки при помощи специального гибкого эндоскопа. Данный метод обладает высокими показателями достоверности, однако сама по себе процедура достаточно болезненна и проводится с применением седации или внутривенного наркоза [3]. Также одним из недостатков колоноскопии является высокая стоимость этого метода диагностики. Учитывая перечисленные недостатки, применять колоно-скопию для скрининга широких масс населения нецелесообразно. В последнее время появляется все больше предложений по генетической диагностике КРР. В этом направлении особый интерес представляют эпигенетические маркеры, такие как профили микроРНК и аберрантное метилирование [4, 5]. Метилированная ДНК является достаточно информативным биомаркером. Наличие и количество метилированной ДНК можно детектировать в образцах крови или плазмы. Метилирование обширных регионов CpG-островков -основное эпигенетическое изменение, характерное для процессов канцерогенеза при КРР [6]. На настоящий момент на рынке представлены зарубежные коммерческие наборы для определения аберрантного метилирования генов SEPT9 и VIM, однако в России они используются только для научных целей, при этом отсут ствует применение их в клинической практике. Ранее нами была проведена работа по оценке параметров диагностическй модели из маркеров SEPT9 и VIM, которая показала высокую эффективность данного подхода [7]. В настоящей работе мы определяли наличие аберрантного метилирования в генах APC, RASSF1A и ITGA4 и оценивали возможность создания диагностической тест-системы на основе всех пяти биомаркеров. Инактивация гена RASSF1A (Ras - ассоциированный домен семейства 1 изоформа А) влияет на развитие многих видов рака, при этом чаще всего подобная инактивация возникает вследствие аберрантного метилирования про-мотерного участка гена. Белок RASSF1A связан с процессами клеточного апоптоза и влияет на клеточный цикл, ингибируя аккумуляцию циклина D1. Таким образом, инактивация гена RASSF1A приводит к подавлению функции опухолевых супрессоров и ингибирует передачу сигнала к клеточному апоптозу [8]. APC белок является негативным регулятором концентрации бета-катенина и взаимодействует с Е-кадгерином, который отвечает за клеточную адгезию. По результатам многочисленных исследований аберрантное метилирование гена APC может приводить к развитию КРР [9-11]. Интегрин-альфа-4, продукт гена ITGA4, участвует в цитолитическом взаимодействии T-лимфоцитов с клетками-мишенями. Метилирование гена ITGA4 также влияет на развитие КРР [12]. При обследовании всех пациентов, включенных в данное исследование, был проведен анализ наличия мутаций в генах KRAS и NRAS. Гены KRAS и NRAS кодируют белки ГТФазы, играющих важную роль в передачах сигнала. Клиническая практика № 4, 2017 http://clinpractice.ru 9 Оригинальные исследования Продукты генов KRAS и NRAS являются ключевыми молекулами в нисходящем сигнальном пути рецептора человеческого эпидермального фактора роста (EGFR) - сложного сигнального каскада, принимающего участие в развитии и прогрессировании рака [13, 14]. Тестирование генов, кодирующих белки семейства RAS (KRAS и NRAS) позволяет отобрать пациентов с диким типом (без мутации) генов KRAS и NRAS, у которых можно достигнуть ответа при лечении моноклональными антителами, блокирующими белок EGFR [15]. В данном исследовании мы сопоставляли статус мутации генов семейства RAS с наличием аберрантного метилирования в выбранных нами генах. Задачи этого исследования включали в себя анализ метилирования промотерных участков генов APC, RASSF1A и ITGA4 у пациентов с КРР и формирование высокоэффективной диагностической модели на основании полученных нами ранее и новых данных по метилированию. Материалы и методы Работа была одобрена локальным этическим комитетом, выполнена в соответствии с требованиями GCP (Good Clinical Practice) и Хельсинской декларацией по защите прав человека. Исследование включало 150 парных образцов опухолевой ткани с известным статусом мутации генов семейства RAS и окружающей гистологически неизмененной ткани пациентов с аденокарциномой прямой кишки, проходивших лечение в Республиканском клиническом онкологическом диспансере Министерства здравоохранения Республики Татарстан в Таблица 1 Клиническая характеристика пациентов 2008-2012 годах (табл. 1). Каждый пациент подписал добровольное информированное согласие на участие в проведении исследования. Опухоли классифицированы в соответствии с TNM-классификацией Международного противоракового союза и описаны гистологически на основании классификации Всемирной Организации Здравоохранения (ВОЗ). Для отбора образцов с высоким содержанием опухолевых клеток проводили дополнительный гистологический анализ микросрезов. Отбирали образцы из первичных очагов с содержанием опухолевых клеток не менее 70%. Выделение ДНК осуществлялось набором QIAamp DNA FFPE Tissue Kit («Qiagen», Германия), концентрацию суммарной ДНК в водном растворе оценивали на спектрофотометре NanoVue Plus («GE Healthcare», Великобритания). Бисульфитная конверсия и очистка проводились наборами EpiTect Fast Bisulfite Conversion Kit («Qiagen», Германия) с помощью автоматической станции пробоподготовки QIAcube («Qiagen», Германия). Изучение профилей метилирования производилось с помощью метода MethyLight PCR c олигонуклеотидами (табл. 2), подобранными на локусы, содержащими дифференциальнометилируемые CpG-островки, на приборе StepOnePlus™ Real-Time PCR Systems («Applied Biosystems», США). Статистический анализ данных проводили с применением точного критерия Фишера. Уровень значимости принят равным 0,05. Конкор-дантность данных по метилированию оценивали с помощью непараметрической ранговой корреляции Спирмана. Значимость корреляции по Спирману (Rs) проверяли с помощью t-теста Стьюдента: с числом степеней свободы v = N-2, где N - размер выборки. Уровень значимости принят равным 10-6. Чувствительность и специфичность маркеров оценивались с помощью ROC-анализа (MedCalc.2 software) Результаты и обсуждение Поиск и создание новых диагностических методов - одна из главных задач современной медицины, ориентированной на персональный подход к пациентам. Применение этих методов должно обеспечить успешный результат у индивидуума или популяции в целом, а также повлиять на решение врача в вопросах диагностики заболевания и ведения больного (лечения, реабилитации). Для характеристики информативности диагностических методов исследования Пол Количество мужской 72 женский 78 Возраст >50 124 <50 26 Стадия опухоли Т2М0 11 Т3М0 36 Т4М0 38 Т2М1 2 Т3М1 18 Т4М1 28 10 Клиническая практика № 4, 2017 http://clinpractice.ru Оригинальные исследования Таблица 2 Параметры праймеров и зондов для ПЦР в режиме реального времени Ген Последовательность, 5’-3’ Длина продукта Условия реакции, 0С APC Праймер-FM,5'TAGTAAATAGTGAGTATTCGATAGATGTT3',56С Праймер-RM, 5' CGAACACTACTTCGCTATTCTATC 3',56С Зонд - ACCATTACTACCTAAACAACCGAATCTCAA-BHQ1, 61C 172 57 RASSF1A Праймер-FM, TTTCGTCGTTTAGTTTGGATTTTGG,58C Праймер-RM, CTCCCGCAACTCAATAAACTCAAA,59C Зонд - CCCGACATAACCCGATTAAACCCGTACTT -BHQ1, 66C 153 58 ITGA4 F: AAAGAATTGGACGGTTTTTC, 61C R: TATAACCCCAAACTACGCG, 63,4C Зонд - CGCTATAACCGCCCAACCCGA-BHQ1, 72C 110 72 служат такие параметры, как чувствительность (доля истинноположительных результатов среди всех проведенных тестов) и специфичность (доля истинноотрицательных результатов среди здоровых лиц в группе исследуемых). В нашем исследовании подтвердилось наличие метилированных промотерных участков генов APC, RASSF1A и ITGA4. ДНК образцов опухоли было достоверно чаще метилировано, чем ДНК образцов прилежащей ткани. При этом наибольшая разница наблюдалась для гена ITGA4 (чувствительность 78%, специфичность 92,7%) (таблица 3). Метилирование в данных генах является результатом процесса канцерогенеза, при этом ген ITGA4 не является биологически значимыми маркером, однако ценность его как клинического маркера высока, так как в отличие от биологически значимых маркеров, таких как APC (чувствительность 32%, специфичность 93,3%) и RASSF1 (чувствительность 85,3%, специфичность 56,7%) обладает высокими показателями как чувствительности, так и специфичности. При анализе образцов пациентов с КРР на наличие мутаций в генах KRAS или NRAS, 60% пациентов имели нормальную сигнальную систему EGFR и дикий тип гена KRAS; остальные 40% были носителями мутантного варианта генов семейства RAS. Из обнаруженных 40% мутаций только 10% приходится на ген NRAS, остальные мутации были детектированы в гене KRAS. Распределение частот типов мутаций полностью совпало с представленной информацией по ним в базах COSMIC, ENSEMBL и NCBI. В данном исследовании мы анализировали наличие мутации в генах KRAS или NRAS 100 90 80 70 60 50 40 30 20 10 0 I, Т N SEPT9 .. II N N VTM АРС IRAS+ ■RAS- RASSF1A N ITGA4 Рис. 1. Процент метилированных образцов в зависимости от статуса мутации генов, кодирующих белки семейства RAS. Клиническая практика № 4, 2017 http://clinpractice.ru 11 Оригинальные исследования и аберрантного метилирования генов APC, RASSF1A и ITGA4. Полученные данные мы объединили с раннее установленными частотами аберрантного метилирования в генах SEPT9 и VIM. Таким образом, оказалось, что в группе пациентов, имеющих мутации в генах KRAS или NRAS, ДНК опухолевых образцов достоверно чаще метилировано в генах SEPT9 (p = 0.0018) и ITGA4 (p = 0.0044), в отличие от ДнК опухолевых образцов пациентов, не имеющих данные мутации (рис.1). В рамках данной работы был рассчитан индекс метилирования для каждого образца и проверены параметры чувствительности и специфичности как для совокупности маркеров, так и для каждого маркера в отдельности. За пороговое значение для анализа совокупности маркеров был взят индекс метилирования, равный 0,4. Под индексом метилирования понимается отношение числа метилированных локусов к общему числу локусов модели. При этом значении система из маркеров имеет максимальные показатели чувствительности и специфичности (82,7% и 97,3% соответственно) (рис. 2). AUC, показатель интегральной оценки качества и предсказательной способности модели, составляет 0,96, что говорит о высоком качестве модели. По сравнению с нашей предыдущей моделью, состоящей из маркеров SEPT9 и VIM [7], представленная модель, включающая пять маркеров, на 19,3% более специфична. Эффективность диагностической тест-системы напрямую зависит от показателей, включенных в нее биомаркеров. Гены SEPT9, VIM, ITGA4 показали высокие значения обоих параметров. Для генов APС и RASSF1A высокий показатель был лишь у одного параметра. Тем не менее, в совокупности данные биомаркеры обеспечивают хороший диагностический результат. Учитывая то, что диагностическая система может быть основана на малоинвазивном методе определения статуса метилирования в плазме крови, можно предложить ее использование в обширных скрининговых программах, а также для оценки динамики заболевания у пациентов КРР. Выводы В нашей работе было проанализировано наличие метилирования в генах APC, RASSF1A и ITGA4 у пациентов с КРР. В образцах опухолевых тканей было подтверждено наличие метилирования CpG-островков в промотерных областях выбранных генов. Наибольшая разница в метилировании между опухолевой и здоровой тканью наблюдалась для гена ITGA4 (чувствительность 78%, специфичность 92,7%). Для гена APC (чувствительность составила 32%, специфичность - 93,3%), для гена RASSF1 (чувствительность была 85,3%, специфичность - 56,7%. Ранее полученные данные по аберрантному метилированию генов SEPT9 и VIM и новые данные по генам APC, RASSF1A и ITGA4 мы сравнили со статусом мутации в генах KRAS и NRAS. Было обнаружено, что в группе пациентов, имеющих мутации в генах KRAS или NRAS, ДНК опухолевых образцов достоверно чаще метилировано в генах SEPT9 (p = 0.0018) и ITGA4 (p = Совокупность маркеров г* > 100 80 60 Ui ф 40 со 20 О Sensitivity: 82,7 Specificity: 97,3 Criterion : >0,4 / / _l і і і I і і і I і і і I і і і L 0 20 40 60 80 100 100-Specificity 100-Specificity Рис. 2. Сравнение результатов ROC-анализа для каждого маркера в отдельности и для совокупности маркеров. 12 Клиническая практика № 4, 2017 http://clinpractice.ru Оригинальные исследования 0.0044), в отличие от ДНК опухолевых образцов пациентов, не имеющих данных мутаций. При статистическом анализе эффективности диагностической тест-системы было показано, что наша модель, включающая в себя пять маркеров метилирования (APC, RASSF1A, ITGA4, SEPT9 и VIM), обладает наилучшими показателями чувствительности и специфичности (82,7% и 97,3% соответственно). Полученную модель диагностической тест-системы предлагается использовать для скрининговых задач и оценки динамики КРР.
×

References

  1. Jemal A., Center M.M., DeSantis C., Ward E.M. Global Patterns of Cancer Incidence and Mortality Rates and Trends. Cancer Epidemiol. Prev. Biomark. 2010;19:1893-1907.
  2. Давыдов М.И., Аксель Е.М. Заболеваемость злокачественными новообразованиями населения России и стран СНГ в 2008 г. Вестник РОНЦ им. Н.Н. Блохина РАМН. 2010. Т. 21, прил.1. С. 52-86.
  3. Шахшаль Г. 2012. Практическая колоноскопия. М.: «МЕДпресс-информ».192 с.
  4. Khare S., Verma M. Epigenetics of Colon Cancer. In Cancer Epigenetics. 2012. Humana Press, Totowa, NJ. 177-185.
  5. Соколова Е.А., Боярских У.А., Ширшова А.Н., Кель А.Э., Филипенко М.Л. Биомаркеры для своевременной диагностики колоректального рака. Клиническая лабораторная диагностика. 2015; 60 (12): 15-23.
  6. Kim M.S., Lee J., Sidransky D. DNA methylation markers in colorectal cancer. Cancer Metastasis Rev. 2010; 29: 181-206.
  7. Бровкина О.И., Гордиев М.Г., Ходырев Д.С., Никитин А.Г., Аверьянов А.В. Использование аберрантно метилированных генов SEPT9 и VIM для клинической диагностики колоректального рака. Клиническая практика. 2016; 28: 15-19.
  8. Dammann R., Schagdarsurengin U., Strunnikova M., Rastetter M., Seidel C., Liu L., Tommasi S., Pfeifer G.P. Epigenetic inactivation of the Ras-association domain family 1 (RASSF1A) gene and its function in human carcinogenesis. Histol. Histopathol. 2003; 18:665-677.
  9. Fodde R. 2002. The APC gene in colorectal cancer. Eur. J. Cancer Oxf. Engl. 1990; 38: 867-871.
  10. Aoki K., Taketo M.M. Adenomatous polyposis coli (APC): a multi-functional tumor suppressor gene. J. Cell Sci. 2007; 120: 3327-3335.
  11. Fodde R., Smits R., Clevers H. APC, Signal transduction and genetic instability in colorectal cancer. Nat. Rev. Cancer. 2001; 1: 55-67.
  12. Gerecke C., Scholtka B., Löwenstein Y., Fait I., Gottschalk U., Rogoll D., Melcher R., Kleuser B. Hypermethylation of ITGA4, TFPI2 and VIM promoters is increased in inflamed colon tissue: putative risk markers for colitis-associated cancer. J. Cancer Res. Clin. Oncol. 2015; 141: 2097-2107.
  13. Bar-Sagi D., Hall A. Ras and Rho GTPases: a family reunion. Cell. 2000; 103: 227-238.
  14. Мазуренко Н.Н., Цыганова И.В., Гагарин И.М., Чуев Ю.В., Мочальникова В.В., Коломейцева А.А., Горбунова В.А. Мутации EGFR и KRAS, важные для таргетной терапии немелкоклеточного рака легких. Молекулярная Медицина. 2013;6: 55-59.
  15. Писарева Е.Е., Любченко Л.Н., Коваленко C.П., Шаманин В.А. Анализ мутаций в генах KRAS и BRAF при раке толстой и прямой кишки в российской популяции. 2016; 15: 36-41.

Statistics

Views

Abstract: 334

PDF (Russian): 170

Cited-by

CrossRef: 1

  1. Zhang X, Wan S, Yu Y, Ruan W, Wang H, Xu L, et al. Identifying potential DNA methylation markers in early-stage colorectal Cancer. Genomics. 2020;112(5):3365. doi: 10.1016/j.ygeno.2020.06.007

Article Metrics

Metrics Loading ...

PlumX

Comments on this article


Copyright (c) 2017 Brovkina O.I., Gordiev M.G., Toropovskiy A.N., Khodyrev D.S., Nikitin A.V., Averyanov A.V.

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies