Investigations of possible horizontal gene transfer from Agrobacterium to some representatives of the family Solanaceae

Cover Page

Abstract


The development of methods of genetic engineering of plants poses in modern society the question of the safety of transgenic plants. Transformation of plants has been criticized as artificial process performed only in the laboratory. At the same time there is evidence that some members of the genus Nicotiana and Linaria contain sequences homologous to the T-DNA of Agrobacterium rhizogenes in their genomes. The question: whether there are other examples of horizontal gene transfer from Agrobacterium to the plant among the representatives of the family. Solanaceae, is still actual. We performed screening of representatives of four genera of the family Solanaceae for the presence of sequences homologous to oncogeniclike genes rolB, rolC, ORF13, ORF14. New examples of horizontal gene transfer were not detected. Apparently, the presence of sequences homologous to oncogenes of A. rhizogenes in the genome of nontransformed plants is not common to the whole family Solanaceae and is characteristic only of the some species of the genus Nicotiana.

Full Text

ВВЕДЕНИЕ Под горизонтальным переносом генов понимают передачу генетического материала, между организмами, которых нельзя определить в понятиях родители и потомки. Для прокариотических организмов это — один из ключевых механизмов появления комбинационной изменчивости. Среди эукариотических организмов также возможен горизонтальный перенос генов. Одним из примеров горизонтального переноса генов с участием высших эукариот является наличие в геномах ряда «нетрансформированных» растений, в частности некоторых видов в пределах родов Nicotiana (сем. Solanaceae) и Linaria (сeм. Plantaginaceae) последовательностей, гомологичных Т-ДНК Agrobacterium rhizogenes (White et al., 1983; Furner et al., 1986; Meyer et al., 1995; Frundt et al., 1998; Matveeva et al., 2012). Патогенная почвенная бактерия Agrobacterium переносит и встраивает в геном растения Т-ДНК — фрагмент большой плазмиды Ti или Ri, вызывающей образование опухолей — корончатых галлов или «бородатых» корней соответственно. Таким образом, формируются трансгенные ткани на зараженном растении, после чего оно, как правило, погибает (Schell et al.,1979; Schell and Van Montagu, 1977; White et al., 1982, 1985). Вместе с тем Т-ДНК-подобные последовательности, присутствующие в геномах табака и льнянок, сохранились в ходе эволюции и по настоящее время передаются в ряду половых поколений. Представляет интерес выяснить, является ли способность к захвату Т-ДНК и сохранению ее в геноме свойством определенных видов растений, или Т-ДНК-содержащие виды случайно распространены среди представителей различных семейств. Поиск онкогеноподобных последовательностей в пределах сем. Solanaceae был проведен только у представителей рода Nicotiana и нескольких видов других родов (Intrieri and Buiatti, 2001). Методом блот-гибридизации геномной ДНК по Саузерну и ПЦР онкогеноподобные последовательности были выявлены у N. glauca, N. cordifolia, N. debneyi. N. tabacum, N.tomentosiformis, N. otophora, N. suaveolens N. benavidesi, N. setchelli, N. arentsi, N. acuminata, N. gossei, N. exigua (Intrieri and Buiatti, 2001). Интересно отметить, что данные последовательности обнаружены у всех исследованных представителей указанных видов, вне зависимости от экологических и географических условий их произрастания. То есть наличие Т-ДНК в геноме является характеристикой вида (White et al., 1983; Furner et al., 1986; Meyer et al., 1995; Frundt et al., 1998; Intrieri, Buiatti, 2001). Не исключено, что последовательности Т-ДНК из разных видов агробактерий могли в процессе эволюции независимо встраиваться в геномы различных видов растений. В геномах ряда растений они сохранились до наших дней (например, у представителей родов Nicotiana и Linaria), в то время как у других растений могли быть утеряны. Долгое время анализ большого количества видов на наличие онкогеноподобных последовательностей был затруднителен по причине несовершенства используемых методов для массового скрининга. Ранее для этого использовали два основных метода: блот-гибридизацию геномной ДНК по Саузерну, с последующим клонированием и секвенированием фрагментов, дающих позитивный гибридизационный сигнал; классические варианты ПЦР с последующей гибридизацией по Саузерну наработанных продуктов и секвенированием фрагментов с позитивным гибридизационным сигналом (White et al., 1983; Intrieri and Buiatti, 2001). В первом случае трудности были обусловлены длительностью экспериментов. Во втором — основные проблемы были связаны с подбором зонда, который, с одной стороны, не давал бы ложных гибридизационных сигналов из-за перекрывания своей последовательности с последовательностями праймеров, а с другой стороны, был бы достаточно протяженным для эффективного мечения (Matveeva et al., 2003). Развитие и широкое распространение метода ПЦР в реальном времени открывают новые возможности в геномных исследованиях. Мы использовали модификацию метода, называемую “TaqMan”, которая позволяет совмещать в одной реакции преимущества ПЦР и гибридизации по Саузерну. Использование вырожденных праймеров и зонда, сконструированных к консервативным частям исследуемого гена, позволяет обнаруживать онкогены, последовательности которых несколько отличаются от описанных ранее (Matveeva et al., 2012). Целью данной работы является изучение возможностей горизонтального переноса генов от агробактерий к представителям семейства Solanaceae. Конкретная задача заключается в поиске последовательностей, подобных онкогенам Т-ДНК Agrobacterium rhizogenes в геномах растений рода Solanum (sec. Lycopersicon, Petota), Capsicum и Physalis с использованием метода ПЦР в реальном времени. Свое исследование мы сфокусировали на данных объектах не случайно. Одной из причин была филогенетическая близость исследуемых родов к роду Nicotiana, где Т-ДНК-подобные последовательности обнаружены ранее. Второй причиной является наличие среди представителей исследуемых родов культурных растений, а также видов, вовлекаемых в межвидовую гибридизацию для придания культурным формам новых сельскохозяйственно важных свойств (Thieme et al., 1997, 2010). МАТЕРИАЛЫ В качестве объекта исследований взяты представители рода Lycopersicon (по современной классификации относимые к роду Solanum секции Lycopersicon (Peralta et al., 2006): L. chmielewskii, L. esculentum var. cerasiforme, L. glabratum, L. hirsutum, L. peruvianum, L. pimpinellifolium, L. cheesmanii, L. parviflorum, L. сhilense, рода Solanum: S. acaule, S. ajanhuiri, S. albicans, S. andigenum, S. berthaultii, S. boyacense, S. boyacense, S. canarense, S. canarense, S. cardiophyllum, S. chacoense, S. chaucha, S. chocclo, S. curtilobum, S. demissum, S. demissum, S. doddsii, S. dulcamara, S. fendleri, S. goniocalyx, S. hjertingii, S. hondelmanii, S. hougassi, S. jamesii, S. juzepczukii, S. kurtzianum, S. mamilliferum, S. phureja, S. pinnatisectum, S. pinnatisectum, S. polytrichon, S. riobambense, S. rybinii, S. sparsipilum, S. spegazzinii, S. stenotomum, S. stoloniferum, S. tarijense, S. tenuifilamentum, S. tuberosum, S. vernei, S. verrucosum, S. oplocense, рода Capsicum: C. аnnuum и рода Physalis: Ph. ixocarpa. Растительный материал получен из семян коллекции ВИРа или собран на опытных участках ВИРа. В ходе анализа каждого вида использовали от 5 до 10 растений. В качестве контроля использовали виды рода Nicotiana: N. tabacum, N. langsdorffii, любезно предоставленные Всероссийским НИИ табака, махорки и табачных изделий РАСХН. Штамм Agrobacterium rhizogenes 8196, любезно предоставленный профессором Ondjey M. (Чешские Будуевицы, Чехия), использовали для трансформации растений табака. МЕТОДЫ Для получения асептических растений семена томатов, картофеля и перца обрабатывали смесью 33%-й перекиси водорода, воды и этилового спирта (соотношение 1 : 1 : 2) в течение 15 минут. В условиях ламинарного бокса семена высевали для проращивания на питательную среду Мурасиге-Скуга (МС) без гормонов (Murashige, Skoog, 1962). В дальнейшем растения выращивались в условиях 24-часового светового дня в чашках Петри и кровяных баночках. Культуру бактерии Agrobacterium rhizogenes выращивали на твердой среде LB (Sambrook et al, 1989). Трансформацию растений табака проводили методом листовых дисков (Draper, Skott, 1988). Отбор трансформантов проводился по наличию специфических фенотипических признаков (образование «бородатых» корней). Агробактериальной трансформации с использованием штаммов A. rhizogenes (8196) были подвергнуты 10 листьев табака N. tabacum. Спустя три недели после трансформации с ипользованием штамма 8196 были отобраны девять эксплантов с ярко выраженным проявлением признака «бородатых» корней. Экспланты использовали в качестве позитивного контроля в молекулярно-генетических экспериментах. Выделение ДНК Тотальную ДНК растений выделяли по описанной в литературе методике (Dellaporta et al., 1983). ДНК была выделена из отобранных трансформированных листовых эксплантов N. tabacum. ДНК нетрансформированного табака, перца и томатов была выделена из растений, находящихся на стадии 4–6 листьев. ДНК картофеля, физалиса и паслена была выделена из молодых листьев растений, находящихся в стадии цветения. Во всех случаях вегетативный материал, полученный от различных растений одного вида, был объединен до выделения ДНК. Таким образом, препараты ДНК каждого вида содержали смесь ДНК нескольких растений. Проведение ПЦР Для проверки возможности использования полученных ДНК для проведения ПЦР с заданными праймерами была проведена ПЦР с ДНК исследуемых растений в амплификаторе Терцик («ДНК технологии»), с использованием полуслучайных праймеров SR1 (AGCAGGTCAGGC), SR11 (ACTTACCTGCCCTTC), SR16 (ACTTACCTGCCTGAC), и SR17 (ACTTACCTGCGGGTG) и праймеров к гену убиквитина (Ub-for: atgcagatytttgtgaagac; Ub-rev: accaccacgragacggag). Праймеры синтезированы фирмой «Синтол». ПЦР проводили в объеме 50 мкл. Реакционная смесь содержала 10 нг ДНК, 10 пкМ праймера (-ов), 2,5 U Taq полимеразы (Sileks M), буфер, предложенный фирмой-производителем фермента и 200 мкM каждого dNTP. Контролем на отсутствие контаминации служил результат ПЦР со всеми компонентами, кроме ДНК. Для ПЦР с праймером SR1 использовали программу: 5 мин 93 oC, 33 цикла (17 сек 93 oC, 40 сек 37 oC, 40 сек 72 oC), далее 5 мин 72 oC. ПЦР с использованием праймеров SR11–17 проводили по программе: 5 мин 93 oC, 7 циклов (17 сек 93 oC, 40 сек 46 oC, 40 сек 72 oC), 26 циклов (17 сек 93 oC, 40 сек 48 oC, 40 сек 72 oC), далее 5 мин 72 oC. ПЦР с использованием праймеров к гену убиквитина проводили по программе: 5 мин 93 oC, 33 цикла (17 сек 93 oC, 40 сек 57 oC, 40 сек 72 oC), далее 5 мин 72 oC. Фрагменты разделяли в 1%-м агарозном геле на 1-кратном буфере ТВЭ. В качестве маркера молекулярной массы использовали набор 100bp + 1,5 kb ladder фирмы «Сибэнзим». Документацию результатов проводили с использованием системы ввода и анализа изображения («Силекс М»). Проведение ПЦР в режиме реального времени ПЦР в режиме реального времени проводили в амплификаторе ПОП-16 К-4Ц, изготовленном в Санкт-Петербургском институте аналитического приборостроения, с использованием праймеров длиной 22–24 нуклеотида к четырем онкогенам Agrobacterium rhizogenes: RolCL: gtcgactgcccgacgatgatgc RolCR: ggcgaagtaggcgctccggata, RolBL: atgcagaaagtgctggaggaa, RolBR: gtgcggccaagcaaggttgtg, ORF13L: ctttacctccmwggccgtggc, ORF13R: ccagtgagacatttgtctgat, ORF14l gstkgaggcggmgctackdgacta, ORF14r: atcaacaatggagttgagtttctc В качестве зондов к ним использовали: RolC_probe: Cy5-tcmtcaccaatcttccgccgtaccag-BHQ2, RolB_probe: R6G-atcgtbgtcgcagcacggcctccattcca-BHQ1, ORF13_probe: Rox-aggaacgacgcasgmtaacagntccccatc-BHQ2, ORF14: FAM-ctcgatcarwctgtgackgtcgacaagc-BHQ1 Праймеры и зонды синтезированы компанией Syntol. Объем реакционной смеси для ПЦР составил 30 мкл. В ее состав вошло 10 нг матричной ДНК, 1,5 единицы Taq полимеразы (Sileks M), буфер, предложенный фирмой-производителем фермента, 200 мкM каждого dNTP, 250 пкM каждого праймера, зонд (в концентрации от 250 до 500 пкМ в зависимости от красителя и степени вырожденности). ПЦР проводили по программе: 5 мин 93 oC, 40 циклов — 15 сек 93 oC, 60 сек 50 oC, 60 сек 72 oC, далее 15 сек 25 oC. При проведении ПЦР в режиме реального времени использовали вырожденные зонды и праймеры, подобранные к самым консервативным участкам последовательностей онкогенов ORF13, ORF14, rolC, rolB A. rhizogenes. Для проведения ПЦР в режиме реального времени использовали программу, позволяющая одновременно анализировать прохождение реакции с 4-я праймерами (технология мультиплекс). В качестве положительного контроля наличия онкогенов A. rhizogenes использовалась ДНК из растений N. tabacum, трансформированных штаммом A. rhizogenes (8196). Контролем отсутствия контаминации служила проба со всеми компонентами реакционной смеси, кроме ДНК. РЕЗУЛЬТАТЫ Как следует из данных литературы, поиск последовательностей гомологичных онкогенам агробактерий ведется уже 3 десятилетия (White et al., 1983; Intrieri and Buiatti, 2001) в основном на основе использования метода ПЦР. При этом в большинстве случаев применялись праймеры, специфичные к последовательностям, обнаруженным у N. glauca и N. tabacum. В нашей работе предпринята попытка обнаружить последовательности, подобные агробактериальным онкогенам с использованием праймеров, специфичных к последовательностям онкогенов ORF13, ORF14, rolC, rolB Agrobacterium методом ПЦР в реальном времени. При проведении реакций в качестве положительного контроля использовали ДНК трансформированного N. tabacum, а в качестве контроля на отсутствие контаминации пробу со всеми компонентами реакционной смеси, кроме ДНК. Контролем на прохождение реакции на ДНК разных генотипов растений явилась ПЦР с полуслучайными праймерами и/или с праймерами к гену убиквитина. Только при успешном и стабильном прохождении такой ПЦР ДНК использовалась для анализа наличия в ней онкогеноподобных последовательностей Т-ДНК. При использовании праймеров ORF13, ORF14, rolC, rolB и ДНК трансформированного N. tabacum наблюдалось прохождение реакции. При проведении ПЦР в реальном времени с праймерами ORF 13, ORF14, rolC и ДНК нетрансформированного N. tabacum также выявлено прохождение реакции (табл. 1), что подтверждает факт наличия в геноме нетрансформированного табака последовательностей гомологичных онкогенам A. rhizogenes. При проведении ПЦР в реальном времени с использованием ДНК N. langsdorffii не наблюдалось прохождения реакции с праймерами ORF13, ORF14, rolC, rolB (табл. 1), что соответствует данным других исследователей (Intrieri M. C., Buiatti M., 2001). Это указывает на правомочность использования данного метода для поиска соответствующих последовательностей в геномах других растений. При анализе представителей видов семейства Пасленовых (табл. 1) показано отсутствие реакции с праймерами к агробактериальным онкогенам ORF13, ORF14, rolC, rolB, что может быть интерпретировано как отсутствие в геномах этих видов последовательностей, подобных онкогенам ORF13, ORF14, rolC, rolB A. rhizogenes. ОБСУЖДЕНИЕ В ходе исследований по поиску последовательностей, подобных онкогенам A. rhizogenes, были проанализированы представители двух видов рода Nicotiana, девяти видов секции Lycopersicon рода Solanum, сорока одного вида секции Petota рода Solanum, одого вида рода Capsicon и одного вида рода Physalis. Следует отметить, что семейство Solanaceae характеризуется большим видовым разнообразием, включая около 2500 видов, объединенных в порядка 90 родов. Род Solanum — самый многочисленный и включает по разным классификациям от 900 до 1700 видов (Антонова, 2006). То есть наше исследование не претендует на всецелую характеристику семейства Solanaceae по наличию Т-ДНК в геномах растений. Вместе с тем в работе представлены данные по наиболее интересным с фундаментальной и прикладной точек зрения видам данного семейства. Поиск проводили методом ПЦР в реальном времени, который сочетает в себе проведение ПЦР и гибридизации с зондом, гомологичным части последовательности агробактериального онкогена (TaqMan ПЦР). Этот метод позволяет найти онкогеноподобные последовательности даже при их отличии от ранее обнаруженных, поскольку праймеры и зонды выбраны к самым консервативным участкам генов и являются вырожденными. Тем не менее в процессе работы не было обнаружено новых примеров горизонтального переноса генов от агробактерий к растениям. Филогенетически рода Solanum, Capsicum и Physalis близки роду Nicotiana. Представители этих родов, как и виды Nicotiana, в основном являются травами или небольшими кустарниками. У части из них экспериментально показан высокий уровень регенерационной способности. У межвидовых гибридов Lycopersicon описано возникновение опухолей, как и у гибридов табака (Байдербек, 1981). Опухолеобразование у гибридов табака долгое время объясняли экспрессией онкогеноподобных последовательностей (Aoki, 2004). Обсуждалась возможность объяснения способности к опухолеобразованию у других растений за счет привнесения агробактеоиальных генов. Поскольку в ходе данной работы не обнаружено новых случаев горизонтального переноса онкогенов от агробактерий к растениям различных родов Solanaceae (кроме табака), можно предполагать, что присутствие в геноме нетрансформированных растений последовательностей, гомологичных онкогенам A. rhizogenes, не является общим признаком для многих представителей семейства Solanaceae, а характерно только для некоторых видов рода Nicotiana. Поиск новых случаев горизонтального переноса генов у растений важен для фундаментальной и прикладной науки. В исследованиях по этой тематике целесообразно сосредоточиться на изучении видов, у которых перенесенные последовательности могли бы закрепиться в геноме в череде последовательных поколений. Это должны быть травянистые, двуили однолетние растения способные хорошо размножаться как семенами, так и вегетативно. Инфицирование агробактерией происходит только в случае поранения растения. Растения, несущие вставку Т-ДНК, регенерируют из пораненной области растения. Таким образом, высокая способность к регенерации является существенным ограничением при выборе растений для исследования (Schell et al., 1979). Поскольку показано, что агробактериальная трансформация однодольных растений затруднена, то, скорее всего онкогеноподобные последовательности стоит искать в двудольных растениях. По всей видимости, признак опухолеобразования у гибридов не является существенным при выборе объектов исследования, поскольку экспрессия онкогеноподобных последовательностей у представителей рода Nicotiana выявляется не только в опухолях гибридов, но и во многих тканях родительских растений (Intrieri, Buiatti, 2001; Aoki et al., 2004). Кроме того, следует учитывать, что не все из онкогенов кодируют функциональные продукты. Работа выполнена при финансовой поддержке программы BRHE фонда CRDF и Минобразования РФ, грант ST-012-0, а также гранта Президента РФ для молодых кандидатов наук МК-5352.2006.4 и за счет средств тематического плана НИР СПбГУ № 0.37.87.2011 «Метагеномный анализ микробиома как многофункционального высоко интегрированного биосферного «интерфейса».

About the authors

Olga Alekseyevna Kulayeva

All-Russia Research Institute for Agricultural Microbiology

Email: koa1983@yandex.ru
Candidate of Biological Sciences, Laboratory of molecular and cellular biology

Tatiana Valeryevna Matveeva

Saint-Petersburg State University

Email: radishlet@gmail.com
Candidate of Biological Sciences, Senior Researcher

Lyudmila Alekseyevna Lutova

Saint-Petersburg State University

Email: la.lutova@gmail.com
Doctor of Biological Sciences, Professor. Deptartament of Genetics and Biotechnology

References

  1. Литература
  2. Антонова О. Ю. 2006. Полиморфизм органельных ДНК у сортов картофеля, видов рода Solanum секции «Pеtоtа» и межвидовых соматических гибридов: Дис.. канд. биол. наук: 03.00.15 СПб., 149 с.
  3. Байдербек Р. 1981. Опухоли растений. Проблема развития растений. Пер. с нем. Твердый переплет. 304 с.
  4. Aoki S. 2004. Resurrection of ancestral gene: functional and evolutionary analyses of the Ngrol genes transferred from Agrobacterium to Nicotiana // J. Plant. Res. Vol. 117. P. 329–337.
  5. Dellaporta S. T., Wood J., Hicks, 1983. Plant DNA minipreparation // Plant Molecular Biology Reporter. Vol. 1 P. 19–21.
  6. Draper J., Scott R., 1988. Plant genetic transformation and gene expression. A laboratiry manual. Blackwell Scientific Publications. — 408 p.
  7. Frundt C., Meyer A. D., Ichikawa T., Meins F. J., 1998. A tobacco homologue of the Ri-plasmid ORF13 gene causes cell proliferation in carrot root discs // MGG. Vol. 259, N 6. P. 559–568.
  8. Furner I. J., Huffman G. A., Amasino R. M. et al., 1986. An Agrobacterium transformation in the evolution of the genus Nicotiana // Nature. Vol. 319. P. 422–427
  9. Intrieri M. C., M. Buiatti., 2001.The horizontal transfer of Agrobacterium rhizogenes genes and evolution of the genus Nicotiana // Mol. Phyl. Evol. Vol. 20, N. 1. P. 100–110
  10. Matveeva T. V., Bogomaz D. I., Pavlova O. A. et al., 2012. Horizontal gene transfer from Agrobacterium to the plant Linaria in nature // MPMI. Vol. 25, N 12. — P. 1542–1551.
  11. Matveeva T. V., Lutova L. A., Bogomaz D. I., 2006. Search for T-DNA like sequences in plant genomes, using degenerate primers and probe // Biotechnology in the Agriculture and Food Industry. Nova Science Publishers Inc. — Chapter 17. — P.101.
  12. Matveeva T. V., Lutova L. A., Wood D., Nester E. W., 2003. Search for sequences homologous to Agrobacterium T-DNA in different plant genomes // Biology of Plant-Microbe Interactions. Vol. 4. P. 526–529
  13. Meyer A. D., Ichikawa T., Meins F., 1995. Horizontal gene transfer: regulated expression of a tobacco homologue of the Agrobacterium rhizogenes rolC gene // MGG. Vol. 249. P. 265–273.
  14. Murashige T., Skoog F., 1962. A revised medium for rapid growth and bioassay with tobacco tissue culture // Physiol. Plant. V0l. 15. P. 473–497
  15. Peralta I. E., Knapp S, Spooner D. M., 2006. Nomenclature for wild and cultivated tomatoes // Rep. Tomato Genet. Coop. — Vol. 56. — P. 6–12.
  16. Sambrook J., Fritsch E. F., Maniatis T., 1989. Molecular cloning: a laboratory manual // New York: Cold Spring Harbor Laboratory Press. 723 p.
  17. Schell J., Van Montagu M, De Beuckeleer M. et al., 1979. Interactions and DNA transfer between Agrobacterium tumefaciens, the Ti-plasmid and the plant host // Proc. R. Soc. Lond. B. Biol. Sci. Vol. 204. P. 251–266
  18. Schell J., Van Montagu M., 1977. The Ti-plasmid of Agrobacterium tumefaciens, a natural vector for the introduction of nif genes in plants? // Basic Life Sci; Vol. 9. P. 159–179.
  19. Thieme R., Rakosy-Tican E., Nachtigall M. et al., 2010. Characterization of the multiple resistance traits of somatic hybrids between Solanum cardiophyllum Lindl. and two commercial potato cultivars // Plant Cell Report. Vol. 29. P. 1187–1201.
  20. Thieme R., Darsow U., Gavrilenko T. et al., 1997. Production of somatic hybrids between S. tuberosum L. and late blight resistant Mexican wild potato species // Euphytica. Vol. 97. P. 189–200.
  21. White F. F., Garfinkel D. J., Huffman G. A. et al., 1983.Sequence homologous to Agrobacterium rhizogenes T-DNA in the genomes of uninfected plants // Nature. Vol. 301, N 5898. P. 348–350.
  22. White F. F., Taylor B. H., Huffman G. A. et al., 1985. Molecular and genetic analysis of the transferred DNA regions of the root-inducing plasmid of Agrobactefium rhizogenes // J. Bacteriol. Vol. 164. P. 33–44.
  23. White F. F., Ghidossi G., Gordon M. P., E. W. Nester, 1982.Tumor induclion by Agrobacterium rhizogenes involves the transfer of plasmid DNA to the plant genome // Proc. Natl. Acad. Sci. USA. Vol. 79. P. 3193–3197.

Statistics

Views

Abstract - 544

PDF (Russian) - 325

Cited-By


Article Metrics

Metrics Loading ...

PlumX

Dimensions


Copyright (c) 2013 Kulayeva O.A., Matveeva T.V., Lutova L.A.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies