Genome of Linaria dalmatica contains the homolog of Agrobacterium rhizogenes. rolC gene

Cover Page

Abstract


Examples of horizontal gene transfer involving nuclear genomes of plants are rare. Currently, only two examples were detected in certain species of tobaccos and toadflax. The paper firstly describes the genomic sequence of Linaria dalmatica (L.) P. Mill. 94% similar to that Agrobacterium rhizogenes rolC gene. A possible role of rolC gene and T-DNA in the evolution of Linaria as well as their potential role in the origin of plant species are argued.

Full Text

Введение Горизонтальный, или латеральный перенос генов (ГПГ) — это передача отдельных участков генома между объектами, которые не являются родителями и потомками и чаще всего филогенетически удалены друг от друга. Как правило, ГПГ осуществляется при помощи специализированных векторных систем (плазмид, бактериофагов и др.), но может протекать и путем непосредственного поглощения экзогенной ДНК (при генетической трансформации). Способностью к ГПГ обладают многие организмы, в частности вирусы, бактерии и некоторые виды грибов. Активный перенос генов может происходить в симбиотических, паразитарных или ассоциативных системах, где осуществляется физический контакт клеток. У прокариотов ГПГ широко распространен, является эволюционно закрепленным механизмом изменчивости (Koonin et al., 2001) и играет важную роль в видообразовании (Doolittle, 1999; Ochman et al., 2000). У эукариотов частота ГПГ ниже, что связывают с усложнением их генетического аппарата. У многоклеточных редко встречается явление латерального переноса и закрепления генов. Немногочисленные примеры ГПГ связаны с захватом прокариотических последовательностей в паразитарных системах (Huang et al., 2004; Andersson, 2005; Fenn et al., 2006; Hottop, 2006; Ricard et al., 2007; Gladyshev, 2008; Andersson, 2009). У ряда цветковых растений бактерия Agrobacterium rhizogenes вызывает заболевание «бородатый корень» (Riker et al., 1930). В составе плазмиды pRi имеется участок Т-ДНК, который способен интегрироваться в растительный геном. Экспрессия генов Т-ДНК изменяет физиологическое состояние растительного организма, в частности нарушает баланс фитогормонов. Важно отметить, что в норме привнесенные последовательности Т-ДНК не наследуются. Однако известно несколько примеров, когда перенос Т-ДНК в геном растения являлся микроэволюционным событием. Так, у некоторых представителей родов Nicotiana и Linaria были выявлены последовательности, сходные с таковыми агробактериальных rol-генов (White et al., 1983; Matveeva et al., 2012). Для табака показано, что перенос и закрепление агробактериальных последовательностей происходили неоднократно и независимо друг от друга. По-видимому, интеграция Т-ДНК повлияла на дивергенцию видов рода Nicotiana (Suzuki et al., 2002). В составе Т-ДНК растений были выявлены консервативные последовательности, которые дошли до наших дней практически без изменений; к их числу относится ген rolC. Его последовательность обладает высокой степенью сходства у разных видов табака и у L. vulgaris, не содержит мутаций и не прерывается преждевременными терминирующими кодонами (Aoki, Syono, 1999; Furner et al., 1986; Matveeva et al., 2012; Meyer et al., 1995; White et al., 1983). Анализ гена rolC представляет интерес для изучения функций, которые могла выполнять Т-ДНК после интеграции в растительный геном. Т-ДНК подобные последовательности смогли закрепиться в геномах растений разных видов и родов, причем часть из них сохранилась практически неизменной. Поскольку данные мотивы не были элиминированы, то можно предположить, что они придали растению определенные конкурентные преимущества. В связи с необходимостью обнаружения новых примеров ГПГ от агробактерий к высшим растениям и, учитывая консервативность гена rolC, мы провели анализ вида L. dalmatica на предмет наличия нуклеотидных последовательностей, гомологичных этому гену у A. rhizogenes. Методы, использовавшиеся в ранних исследованиях — блот-гибридизация по Саузерну тотальной растительной ДНК и Т-ДНК, ПЦР-анализ с последующей гибридизацией (Intrieri, Buiatti, 2001; White et al., 1983) — обладают рядом недостатков: низкая чувствительность, трудоемкость и невозможность анализировать большое количество образцов за короткий промежуток времени, а также риск получения ложных положительных результатов. Для проведения поисков среди широкого спектра видов нами был разработан подход, основанный на ПЦР в режиме реального времени с использованием вырожденных праймеров и зондов. Система «праймеры–зонд» была подобрана таким образом, чтобы можно было детектировать группу родственных последовательностей. Для зондов были использованы разные флуорофоры, чтобы можно было одновременно выявлять разные последовательности в мультиплексной реакции (Matveeva et al., 2006). Материал и методы Семена Linaria dalmatica (L.) Mill. и L. vulgaris L. стерилизовали 5 мин 20 %-й перекисью водорода, промывали стерильной дистиллированной водой и помещали на твердую среду Мурасиге–Скуга (Murashige, Skoog, 1962). Для повышения эффективности прорастания материал выдерживали в темноте при +4 °С, а затем переносили в люминостат с комнатной температурой. Культура Agrobacterium rhizogenes (штамм 8196 коллекции Freie Universität Berlin, Берлин, Германия), была любезно предоставлена проф. Т. Schmulling. Для клонирования гена rolC использовали компетентные клетки Escherichia coli DH5α. Отбор трансформантов производили на среде Луриа–Бертрани (LB) (Sambrook, Russell, 2001). Выделение ДНК. Cуммарную ДНК из 2-недельных проростков выделяли по методу Деллапорта с соавт. (Dellaporta et al., 1983) и хранили при –20 oC. Бактериальную ДНК выделяли по методу Дрейпера с соавт. (1991). ПЦР в режиме реального времени. Оценку качества ДНК проводили при помощи ПЦР в режиме реального времени с использованием праймеров и зонда к гену глицеральдегид-3-фосфат дегидрогеназы (gapdh): GadphF: actggtgtcttcactgacaagg; GadphR: tgacacccacaacaaacatcgg; Gadph_probe: FAM-acaaggcgtcgtctcacttgaagg-BHQ1. Для обнаружения последовательностей, сходных с таковой гена rolC A. rhizogenes, использовали праймеры и зонд, ранее сконструированные для выявления гомологов агробактериальных генов у широкого круга растительных видов (Matveeva et al., 2006). Реакционная смесь содержала 100 нг ДНК, по 2 ммоль каждого dNTP, по 20 пмоль каждого праймера, 10 пмоль зонда и 2,5 ед. «Как-то Taq» полимеразы в 20 мкл буфера («Бигль», Россия). Реакцию проводили на амплификаторе-анализаторе нуклеиновых кислот «АНК-32» (Институт аналитического приборостроения РАН, Россия) в режиме: денатурация — 93 oC, 5 мин; амплификация — 93 oC, 30 c/55 oC, 60 с/72 oC, 60 с (40 циклов). В качестве положительных контролей использовали ДНК L. vulgaris и ДНК A. rhizogenes. Для каждой ПЦР был проведен отрицательный контроль: в реакционную смесь вместо раствора матрицы добавляли дистиллированную воду. Отсутствие увеличения флуоресценции в этом варианте свидетельствует об отсутствии контаминации. «Классическая» ПЦР. Для анализа гена rolC L. dalmatica были сконструированы праймеры, обеспечивающие его полноразмерную амплификацию: RolCL_full: ccattagccgattgcaaacttgca и RolCR_full: catggctgaagacgacctgtgttc. Для этого использовали последовательности, депонированные в GenBank: NgrolC (acc. No: X03432), NtrolC (acc. No: FN667969) и LvrolC (acc. No: EU735069). Реакционная смесь содержала: 100 нг ДНК, по 10 пмоль каждого праймера, по 2 ммоль каждого dNTP и 2,5 ед. «Как-то Taq» полимеразы в 50 мкл буфера («Бигль», Россия). ПЦР проводили в амплификаторе «Терцик» («ДНК-Технология», Россия) в режиме: денатурация — 93 oC, 5 мин; амплификация — 93 °С, 15 с/55 oC, 20 c/72 oC, 30 c; финальная элонгация — 72 oC, 5 мин. Электрофоретическое разделение продуктов ПЦР. 5 мкл ПЦР-продукта разделяли в 1%-м агарозном геле в буфере ТАЕ с добавлением бромистого этидия и сравнивали с маркером длин фрагментов 100 п. н. — 1,5 тыс. п. н. («Сибэнзим», Россия). После обнаружения целевого фрагмента его элюировали из агарозы, переосаждали и растворяли в воде milliQ (Millipore, США). Клонирование ампликонов. Продукт ПЦР клонировали при помощи набора «Clone JET™ Cloning Kit» («Fermentas», США). Полученной генетической конструкцией трансформировали компетентные клетки Escherichia coli DH5α. Колонии трансформантов отбирали на агаризованной среде LB, содержащей 100 мг/л ампициллина («Синтез», Россия). Плазмидную ДНК выделяли, используя «Набор для выделения плазмидной ДНК» («Цитокин», Россия). Секвенирование ампликонов. Секвенирование проводили с использованием праймеров pJET1.2f: cgactcactatagggagagcggc; pJET1.2r: aagaacatcgattttccatggcag («Fermentas», США) и набора «BigDye® Terminator v3.1 Cycle Sequencing Kit» в соответствии с руководством, прилагаемым к прибору ABi Prizm™ 310 Genetic Analyzer (Life Technologies Corporation, США). Результаты исследования Результаты опытов по оценке качества суммарной растительной ДНК с помощью ПЦР в реальном времени представлены на рисунке 1. Кинетика флуоресценции, имеющая на графике форму сигмовидной кривой, свидетельствует о прохождении реакции с исследуемой матрицей. Ген gadph, кодирующий глицеральдегид-3-фосфат дегидрогеназу, представлен единичной копией в геноме растения. Прохождение реакции с праймерами к этому гену говорит о том, что качество матрицы пригодно для дальнейшего анализа, и с ее использованием могут быть амплифицированы другие уникальные последовательности. На следующем этапе исследования суммарная растительная ДНК анализировалась на предмет выявления последовательности, сходной с таковой гена rolC A. rhizogenes. С этой целью для гена rolC была разработана система из вырожденных праймеров и зонда с учетом характера его последовательностей A. rhizogenes, N. glauca, N. tabacum, N. tomentosa, N. tomentosiformis и N. cordifolia (Matveeva et al., 2006). Положительный сигнал в форме сигмовидной кривой, полученный с помощью ПЦР в режиме реального времени (рис. 2), свидетельствует о присутствии в геноме L. dalmatica последовательности, гомологичной гену rolC. Далее с использованием праймеров к полноразмерному гену rolC был получен ампликон для последующего клонирования. Размер ПЦР-продукта L. dalmatica (~500 п. н.) соответствует таковому L. vulgaris и A. rhizogenes 8196 (рис. 3). Отсутствие продукта в негативном контроле говорит об отсутствии контаминации. Для секвенирования нуклеотидной последовательности гена LdrolC его ампликон был клонирован в вектор pJET1.2. Согласно полученным данным, размер нуклеотидной последовательности составляет 543 п.н., начинается со старт-кодона ATG и заканчивается терминирующим кодоном ATT. В рамке считывания нет делеций, инсерций, точковых мутаций и дополнительных стоп-кодонов. Нуклеотидная последовательность гена LdrolC L. dalmatica на 94 % демонстрирует сходство с последовательностью гена LvrolC L. vulgaris, на 94 % — гена rolC A. rhizogenes A4 и на 80 % — гена NgrolC N. glauca. Последовательность гена LdrolC L. dalmatica депонирована в GenBank (acc. No. KC309424). Обсуждение результатов В геноме L. dalmatica нами выявлена последовательность, гомологичная гену rolC A. rhizogenes, которая могла попасть в растительный геном в результате ГПГ. Нуклеотидная последовательность LdrolC обладает высоким уровнем сходства с генами rolC у L. vulgaris и N. glauca и A. rhizogenes. Ген rolC имеется у всех изученных штаммов A. rhizogenes и является самым консервативным из всех rol-генов (Britton et al., 2008). На сегодняшний день нет точных представлений о функции его белкового продукта. Предполагают, что белок RolC обладает способностью расщеплять олигосахариды (Faiss et al., 1996) и таким образом может косвенно воздействовать на программы развития растения, например, высвобождая цитокинины из их конъюгатов. Не исключено, что он может нарушать углеводный баланс растения, изменяя содержание сахарозы, которая выступает субстратом для белка RolC (Nilsson, Olsson, 1997). Продукты ее метаболизма могут использоваться при формировании новых органов — активное всасывание сахарозы при агротрансформации может стимулировать закладку и рост корней (Mohajjel-Shoja et al., 2011). Можно также предположить, что функционирование приобретенного гена rolC могло способствовать выживанию растения-трансформанта и придать дополнительные преимущества в условиях с неоптимальными значениями экологических факторов, например при засолении или засухе (известно, что род Linaria сформировался в период Мессининского кризиса солености на территории Средиземноморского бассейна (Suc, 1984). Очевидно, ген, приобретенный от агробактерий, имел адаптивное значение, поскольку сохранился до наших дней без изменений и подвергался воздействию стабилизирующего отбора. Если бы этот ген не играл никакой роли у разных видов льнянки и табака, то мутации в нем накапливались бы с той же скоростью, что и в межгенных пространствах Т-ДНК. Обнаружение новых примеров ГПГ и характеристика последовательностей переносимых генов способствует пониманию закономерностей коэволюции и симбиоза растений с бактериями. В связи с этим следует отметить, что характер дивергенции привнесенных rol-генов сходен с дивергенцией видов табака (Suzuki et al., 2002). ГПГ способен изменить направление эволюции вида — чужеродный ген может дать начало субпопуляции, которая вытеснит предшествующий вид. Возникновение системы «агробактерии–растение» привело к формированию своеобразного канала для передачи генетический информации. Фактически взаимодействие агробактерий и растений сделало неизбежным появление «природно-трансгенного» организма (растения с Т-ДНК-подобными последовательностями). На практике агробактерии и их способность передавать участок своей плазмиды стали широко применяться в генной инженерии для получения трансгенных организмов. В прикладном аспекте факт существования растений с Т-ДНК-подобными последовательностями может быть использован в качестве контраргумента при критике генно-модифицированных культур, используемых в современном сельском-хозяйстве, медицине, ветеринарии, пищевом производстве и пр. Изучение ГПГ является важной фундаментальной задачей как для выяснения происхождения отдельных генов, организмов или видов, так и для понимания эволюционного процесса в целом. Работа выполнена в соответствии с тематическим планом НИР СПбГУ №0.37.87.2011 «Метагеномный анализ микробиома как многофункционального высокоинтегрированного биосферного «интерфейса» c использованием оборудования Ресурсного центра СПбГУ «Развитие молекулярных и клеточных технологий».

About the authors

Olga Andreyevna Pavlova

Saint-Petersburg State University

Email: olgunja_@mail.ru
Postgraduate student, Deptartament of Genetics and Biotechnology

Tatiana Valeryevna Matveeva

Saint-Petersburg State University

Email: radishlet@gmail.com
Candidate of Biological Sciences, Senior Researcher, Deptartament of Genetics and Biotechnology

Lyudmila Alekseyevna Lutova

Saint-Petersburg State University

Email: la.lutova@gmail.com
Doctor of Biological Sciences, Professor, Deptartament of Genetics and Biotechnology

References

  1. Дрейпер Дж., Скотт Р., Армитидж Ф., Дьюри Г. и др., 1991. Генная инженерия растений / ред. Дрейпер Дж., Скотт Р., Армитидж Ф., Уолден Р. Москва: Мир, 408 с.
  2. Andersson J. O., 2005. Lateral gene transfer in eukaryotes // Cellular and Molecular Life Sci. Vol. 62. P. 1182–197.
  3. Andersson J. O., 2009. Gene transfer and diversification of microbial eukaryotes // Annu. Rev. Microbiol. Vol. 63. P. 177–193.
  4. Aoki S., Syono K., 1999. Synergistic function of rolB, rolC, ORF13 and ORF14 of TL-DNA of Agrobacterium rhizogenes in hairy root induction in Nicotiana tabacum // Plant Cell Physiol. Vol. 40. P. 252–256.
  5. Britton M., Escobar M. A., Dandecar A. M., 2007. The oncogenes of Agrobacterium tumefaciens and Agrobacterium rhizogenes // Agrobacterium: From Biology to Biotechnology / Eds. T. Tzifra, V. Citovsky. New York, Springer. P. 523–563.
  6. Dellaporta S. L., Wood J., Hicks J. B., 1983. Plant DNA Мini Рreparation // Molecular Biology of Plants // Plant Molecular Biology Reporter. Vol. 1. P. 19–21.
  7. Doolittle W. F., 1999. Lateral genomics // Trends Cell Biol. Vol. 9. P. M5–M9.
  8. Faiss M., Strnad M., Redig P. et al., 1996. Chemically induced expression of the rolC-encoded beta-glucosidase in transgenic tobacco plants and analysis of cytokinin metabolism: rolC does not hydrolyze endogenous cytokinin glucosides in planta // Plant J. Vol. 10. P. 33–46.
  9. Fenn K., Conlon C., Jones M. et al., 2006. Phylogenetic relationships of the Wolbachia of nematodes and arthropods // PLoS Pathogens. Vol. 2. P. 0887–0899.
  10. Furner I. J., Huffman G. A., Amasino R. M. et al., 1986. An Agrobacterium transformation in the evolution of the genus Nicotiana // Nature. Vol. 319. P. 422–427.
  11. Gladyshev E. A., Meselson M., Arkhipova I. R., 2008. Massive horizontal gene transfer in bdelloid rotifers // Science. Vol. 320. P. 1210–1213.
  12. Gogarten J. P., Townsend J. P., 2005. Horizontal gene transfer, genome innovation and evolution // Nat. Rev. Microbiol. Vol. 3. P. 679–687.
  13. Hotopp-Dunning J. C., Clark M. E., Oliveira D. C., 2007. Widespread lateral gene transfer from intracellular bacteria to multicellular eukaryotes // Science. Vol. 317. P. 1753–1756.
  14. Huang J., Mullapudi N., Lancto C. A. et al., 2004. Phylogenomic evidence supports past endosymbiosis, intracellular and horizontal gene transfer in Cryptosporidium parvum // Genome Biol. Vol. 5. Article R88.
  15. Intrieri M. C., Buiatti M., 2001. The horizontal transfer of Agrobacterium rhizogenes genes and the evolution of the genus Nicotiana // Mol. Phylogenet. Evol. Vol. 20. P. 100–110.
  16. Koonin E. V., Makarova K. S., Aravind L., 2001. Horizontal gene transfer in prokaryotes: quantification and classification // Annu. Rev. Microbiol. Vol. 55. P. 709–742.
  17. Matveeva T. V., Bogomaz D. I., Pavlova O. A. et al., 2012. Horizontal gene transfer from Agrobacterium to the plant Linaria in nature // Mol. Plant Microbe Interact. Vol. 25. P. 1542–1551.
  18. Matveeva, T. V., Lutova, L. A., Bogomaz, D. I., 2006. Search for T-DNA-Like Sequences in Plant Genomes, Using Real-Time PCR with Degenerate Primers and Probe // Biotechnology in the Agriculture and Food Industry. Ed. Zaikov G. E. New York, Nova Science Publishers. P. 101–104.
  19. Meyer A. D., Ichikawa T., Meins F., 1995. Horizontal gene transfer: regulated expression of a tobacco homologue of the Agrobacterium rhizogenes rolC gene // Mol. Gen. Genet. Vol. 249. P. 265–273.
  20. Mohajjel-Shoja H., Clément B., Perot J. et al., 2011. Biological activity of the Agrobacterium rhizogenes-derived trolC gene of Nicotiana tabacum and its functional relation to other plast genes // Mol. Plant Microbe Interact. Vol. 24. P. 44–53.
  21. Murashige T., Skoog F., 1962. A revised medium for rapid growth and bioassay with tobacco tissue culture // Physiol. Plant. Vol. 15. P. 165–170.
  22. Nilsson O., Olssen O., 1997. Getting to the root: the role of the Agrobacterium rhizogenes rol genes in the formation of hairy roots // Physiologia plantarum. Vol. 100. P. 463–473.
  23. Ochman H., Lawrence J. G., Groisman E. A., 2000. Lateral gene transfer and the nature of bacterial innovation. // Nature. Vol. 405. P. 299–304.
  24. Ricard G., McEwan N. R., Dutilh B. E. et al., 2006. Horizontal gene transfer from bacteria to rumen ciliates indicates adaptation to their anaerobic, carbohydrates-rich environment // BMC Genomics. Vol. 7. P. 1–13.
  25. Riker A. J., Banfield W. M., Wright W. H. et al., 1930. Studies on infectious hairy root of nursery apple trees // J. Agr. Res. Vol. 41. P. 507–540.
  26. Sambrook J., Russell D. W., 2001. Molecular Cloning: A Laboratory Manual, 3rd ed. Cold Spring Harbor (NY), Cold Spring Harbor Lab. Press. 2344 p.
  27. Suc J. P., 1984. Origin and evolution of the Mediterranean vegetation and climate in Europe // Nature. Vol. 307. P. 429–432.
  28. Suzuki K, Yamashita I, Tanaka N., 2002. Tobacco plants were transformed by Agrobacterium rhizogenes infection during their evolution // Plant J. Vol. 32. P. 775–787.
  29. White F. F., Garfinkel D. J., Huffman G. A. et al., 1983. Sequence homologous to Agrobacterium rhizogenes T-DNA in the genome of uninfected plants // Nature. Vol. 301. P. 348–350.

Statistics

Views

Abstract - 610

PDF (Russian) - 280

Cited-By


Article Metrics

Metrics Loading ...

PlumX

Dimensions


Copyright (c) 2013 Pavlova O.A., Matveeva T.V., Lutova L.A.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies