Diversity of the gene of benzoate dioxygenase in bacterial associations isolated from long term organochlorine-contaminated soils

Cover Page
  • Authors: Nazarova E.A.1, Kiryanova T.D.2, Egorova D.O.3,4
  • Affiliations:
    1. «Институт экологии и генетики микроорганизмов Уральского отделения Российской академии наук» - филиал Федерального государственного бюджетного учреждения науки Пермского федерального исследовательского центра Уральского отделения Российской академии наук
    2. Perm State University
    3. Federal State Budget Establishment of Science Institute of Ecology and Genetics of Microorganisms, Ural Branch of the Russian Academy of Sciences
    4.  Perm State University
  • Issue: Vol 17, No 3 (2019)
  • Pages: 13-22
  • Section: 1. Genetic basis of ecosystems evolution
  • URL: https://journals.eco-vector.com/ecolgenet/article/view/10488
  • DOI: https://doi.org/10.17816/ecogen17313-22
  • Cite item

Abstract


Background. Communities of bacteria with specific enzymes are formed in the soil with long-term organochlorine contamination.

The aim of this study was to analyze the diversity of the benA gene encoding the α-subunit of the benzoate 1,2-dioxygenase in aerobic bacterial associations isolated from the soils of the Chapayevsk-city (Samara region, Russia).

Materials and methods. The soil samples were taken on the territory, contaminated with organochlorine compounds for a long time. As a selection factor in the enrichment cultures were used 4-chlorobenzoic acid and chlorobenzene, in the pure cultures – benzoic acid. The isolation of total DNA from bacterial associations was performed using a commercial FastDNA Spin Kit for Soil kit (USA). Amplification was performed on a MyCycler instrument (USA). Determination of the nucleotide sequence was performed on an automatic sequencer Genetic Analyzer 3500XL (USA). The search and analysis for benA gene homologs was carried out using international GenBank databases and BLAST system (http://www.ncbi.nlm.nih.gov).

Results. As a result of selection, 12 associations of aerobic bacteria were obtained. Fragments of the benA gene (α-subunit of benzoate dioxygenase) were obtained with the total DNA of six bacterial associations selected on chlorobenzene and with the total DNA of three bacterial associations selected on 4-chlorobenzoate. Pure cultures of aerobic bacterial strains using benzoic acid as a carbon source were isolated from benA-positive associations. It was established that the amplified fragments with the DNA of the A1, A4, A5, B1, B2, B3, B4 and B6 association strains form a single phylogenetic cluster with the α-subunit gene of the benzoate dioxygenase of the Pseudomonas putida strain KT2440 (level of similarity is 96–98%). The amplified fragment with the DNA of strain B5-170 (association B5) forms a cluster with the gene of the α-subunit of the benzoate dioxygenase of the strain Pseudomonas sp. VLB120 (93% similarity).


Preprint version

BACKGROUND

As a result of mass production and use of the industrial artificially-synthesized substituted and unsubstituted aromatic compounds in the 20th century, a considerable amount of these pollutants have been emitted into the environment. The major storage sites are soils and bottom sediments in industrial regions [1], as seen in the city of Chapaevsk (Samara region, Russia), with its Middle Volga chemical plant of JSC (SVZKh JSC). From 1967 to 1987, SVZKh produced organochlorine compounds included in the list of persistent organic pollutants (POPs; Stockholm Convention, 2001) [2–4]. These compounds have high chemical and physical stability, which results in their long-term persistence in the soil [4].

The availability of POPs in the environment activates adaptation processes in biotopes; in particular, POPs initiate changes in the content of microbiocenosis of contaminated soils. The microorganisms capable of decomposing pollutants and using them as the source of carbon and energy get privilege. Such features are typical for aerobic bacteria having enzymes that can breakdown aromatic rings with broad substrate specificity [5–7]. Bacterial dioxygenases, such as benzoate 1,2­dioxygenase [5, 8], perform the first stage of transformation of POPs and other aromatic compounds by catalyzing penetration of hydroxy groups in the chemically stable aromatic ring of the molecule [8].

Benzoate dioxygenase (BDO; EC 1.14.12.10) has been studied in a wide range of representatives of Gram-positive and Gram-negative aerobic bacteria and decomposes a wide range of aromatic compounds [6, 9–11]. Benzoate dioxygenase is a double-component system; one of the components is oxygenase, consisting of α­ and β­subunits [5, 6], and the other component consists of. The α­subunit appears to be responsible for the BDO substrate specificity [8]. Analysis of the genes determining the α­subunit of BDO demonstrated that they form a separate cluster (subfamily) on the phylogenetic tree of bacterial dioxygenases capable of oxidizing the aromatic ring [8].

The goal of this work was to study the diversity of benA genes coding for the α­subunit of benzoate dioxygenase in aerobic bacterial associations isolated from the soils of Chapaevsk (Samara region, Russia) and in bacteria with further selective cultivation in the presence of the chlorine aromatic compounds. These bacterial associations are formed as a result of adaptation to long-term effects of high concentrations of compounds of the POP group, and can provide information about the evolutionary processes taking place in microbe communities under the effect of the negative environmental factors (chemical contamination).

MATERIALS AND METHODS

Soil characteristics and sampling. Soil samples were taken at the production site of SVJhZ JSC (Chapaevsk, Russia). Previous examination demonstrated that the soil was contaminated with the organochlorine compounds, including ones of the POP group. Concentration of pollutants exceeds maximum allowable concentrations by 3.5–17.8 times [2, 3].

Storage cultivation. Bacterial associations were obtained by means of the storage cultivation of 1g of soil of every sample in 100 ml of the mineral environment K1, with the following composition (g/l): K2HPO4 · 3H2O — 3.2, NaH2PO4 · 2H2O — 0.4, (NH4)2SO4 — 0.5, MgSO4 · 7H2O — 0.15, Ca(NO3)2 — 0.01, with an added selective factor of 4­chlorobenzoic acid (4­CBA) (0.5 g/l) or chlorobenzene (0.5 g/l) [12]. Cultivation was done in 250 ml Erlenmeyer flasks for 30 days in an environmental shaker­incubator ES‑20/60 (BioSan, Latvia) at 120 rpm and 28°C. Twelve bacterial associations were obtained (Table 1).

Extraction of the pure bacterial cultures. Bacterial associations obtained as a result of cultivation on chlorobenzene and 4-CBA were plated on agarized medium with vitamin K1 and 0.3 g/l sodium benzoate as the source of carbon. Cultivation was done in a hemostat ТС‑1/80 SPU (Russia) at 28°C prior to occurrence of colonies. Culture purity was checked during plating on nutrient-rich LB agar of the following composition (g/l): yeast — 0.5, tryptone — 1.0, sodium chloride — 1.0, agar — 1.5.

DNA analysis. DNA from bacterial associations was extracted using the FastDNA Spin Kit for Soil (MP Biomedicals, USA). DNA from pure bacterial cultures was extracted by previously established methods [13]. DNA concentration was determined using the QubitTM Fluorometer (Invitrogen, USA).

Identification of isolated strains. Morphological and physiological properties of isolated bacterial strains were studied using previously established methods [14]. Bacteria were identified during amplification of 16S rRNA using standard bacterial primers 27F 5’­AGAGTTTGATC(A/C)TGGCTCAG‑3’ and 1492R5’­ACGG(C/T)TACCTTGTTACGACTT‑3’ [15] with further amplification (see below). The search for homologous sequences was conducted in the database EzTaxon (http://www.ezbiocloud.net/eztaxon).

Amplification of benzoate dioxygenase gene. Gene benA was amplified by means of bacterial primers of direct benA­F [5’­GCCCACGAGAGCCAGATTCCC‑3’] and reverse benA­R [5’­GGTGGCGGCGTAGTTCCAGTG‑3’] [16]. Primers were selected for the conserved area of gene benA from Acinetobacter baylyi ADP1 (amplified area: nucleotide 175 to nucleotide 712, fragment size - 521 fp) [16]. PCR was conducted using 25μl of mixture containing of buffer for Taq­polymerase with MgCl2 (Sintol, Russia), 0.25 mm of dNTP, 0.5 μm of every primer, two units of active Taq­polymerase (Sintol, Russia) and 2 μl of DNA-matrix. DNA of pure cultures and bacterial associations was used as the DNA-matrix. Amplification was done using MyCycler (Bio­Rad Laboratories, USA) under the following conditions: initial denaturant step at 95°C for 5 min, then 30 cycles (c), 40 c at 94°C, 50 c at 60°C with reduction at each step for 0.4°C, 1 min at 72°C, and for the final step, 7 min at 72°C.

Restriction analysis and DNA visualization. RFLP analysis using restriction endonucleases HhaI and HaeIII (Fermentas, Lithuania) was conducted on amplicons obtained from DNA strains isolated from associations А5, В3 and В5. Electrophoresis was conducted in a horizontal 0.8 % agarose gel in TBE buffer (Thermo Scientific, Lithuania) at a voltage of 10 V/cm. DNA visualization was conducted using UV illumination after staining with ethidium bromide solution (0.5 μg/ml) and was documented using Gel DocTM XR (BioRad, USA). In order to determine the size of amplified fragments, a marker of molecular weight 100bp (Plus DNA Ladder, Fermentas, USA) was used. The anticipated fragment sizes amounts were 520 fp.

Sequencing and analysis of fragments of the benzoate dioxygenase gene. Nucleotide sequences of amplified DNA fragments was determined using a Big Dye Terminator Cycle Sequencing Kit and an automatic sequencer (Genetic Analyzer 3500XL, Applied Biosystems, USA). Searches for homologs of gene benA were conducted in GenBank and analyzed using BLAST (http://www.ncbi.nlm.nih.gov). Multiple alignments of nucleotide sequences were done using the ClustulX program (http://www.ebi.ac.uk). A tree of similarity was constructed with using a sequential clustering algorithm (UPGMA) implemented in the CLC Sequence Viewer 6 (http://www.clcbio.com/products/clc­sequence­viewer). Phylogenetic and cluster analysis and visualization of the tree were conducted in the program MEGA7. Statistical accuracy of branching (bootstrap analysis) was based on 1000 alternative trees. Nucleotide sequences of fragments of genes benA obtained in the research were registered in the database GenBank (see Table 3).

RESULTS AND DISCUSSION

Microbial communities able to decompose the complex organochlorine compounds were formed as a result of the long-term selection in contaminated soils at the site of SVKhZ JSC (Chapaevsk, Russia) [2]. Chlorobenzene and chlorobenzoic acid were used as selective factors in subsequent artificial conditions, as potential metabolites of organochlorine substances present in the soil for a long time. Selection under the effect of high concentrations of these compounds resulted in obtaining associations of the aerobic bacteria designated as А1–А6 and В1–В6 (see Table 1).

Screening of the overall DNA of 12 bacterial associations was conducted for the presence of nucleotide sequences coding for the α­subunit of benzoate 1,2­dioxygenase. PCR products of expected size – 500 fp (Fig. 1) – were obtained from the DNA of nine associations. However, specific amplification of DNA from associations А2, А3 and А6 was not observed. Strains carrying the gene benA may have been eliminated from the microbial community during cultivation on 4­BCS. This phenomenon can be explained with the fact that strains performing hydrolytic dehalogenation of 4-BCS prior to decomposition of the aromatic ring of molecule obtained preference [6, 12]. For a number of strains of Acinetobacter, Arthrobacter and Pseudomonas, multiple genes and enzymes transform 4-BCS by means of hydroxylation, with the further formation of 4­hydroxybenzoic and 3,4­dihydroxybenzoic acid metabolites [6, 12, 17, 18].

Selection of the storage cultures with positive amplification of gene benA resulted in obtaining pure cultures of bacterial strains able to use benzoic acid (benzoic acid sodium salts) as the only source of carbon and energy. Based on the morphophysiological features of the isolated strains in associations А1, А4, В1, В2, В4 and В6, each association had a single strain that could breakdown benzoate: these were strain А1­69, А4­72, В1­169, В2­174, В4­172, В6­173, respectively. Three strains that could breakdown benzoate (А5­67, А5­68, А5­70) were present in the A5 association, five strains in association В3 could use sodium benzoate as the growth substance (В3­162, В3­163, В3­164, В3­165 and В3­166), and four strains that could breakdown benzoate (В5­167, В5­168, В5­170 and В5­171) were present in association В5. Table 2 provides results of examinations that demonstrate the most probable taxonomic position of the isolated bacteria. Based on the analysis of gene 16S рРНК, the strains isolated from benA­positive associations were attributed to the species of Achromobacter, Ochrobactrum and Pseudomonas.

Fragments of the gene coding for the α­subunit of benzoate 1,2-dioxygenase of the anticipated size (~500 fp) were obtained on DNA-matrix of the isolated strains by means of primers benA­F and benA­R. The RFLP analysis of amplified fragments of gene benA (~500 fp long) from the strains of associations А5, В3 and В5 was conducted using restriction endonucleases HhaI and HaeIII. Nucleotide sequences form three groups, corresponding to the associations from which the strains were obtained (data is not presented). Thus, within each group similar genes are available, which allows using one strain of benzoate from these associations for further analysis. Nucleotide sequences of amplified fragments from the DNA of bacterial associations were determined, as well as with DNA of the strain of benzoate isolated from the examined associations (Table 3).

Detected nucleotide sequences demonstrated the highest level of similarity with the gene for the α­subunit of benzoate 1,2­dioxygenase of strains of Pseudomonas. It should be noted that the level of similarity of fragments amplified with the overall DNA association coincided with the level of similarity of fragments of gene benA amplified with the DNA of pure cultures. We used the names of bacterial associations for designation of examined nucleotide sequences during visualization of the phylogenetic tree in the further analysis.

Phylogenetic analysis of the examined nucleotide sequences was conducted based on comparison with homologous sequences from the database GenBank (Fig. 2). Amplified areas of functional genes were similar to the genes of subfamily of BDO bacteria of different phyla performing breakdown of aromatic compounds (see Fig. 2). Past research demonstrates the possibility of horizontal gene transfer allowing decomposition of the chlorine aromatic substances among the Protista [18–21]. This phenomenon can explain the presence of genes with a high level of similarity in the genome of strains and bacterial associations spatially remote from each other.

On the contrary, analysis of the similarity of bacterial decomposition genes from different phyla demonstrates that these genes can have considerable differences [5]. This study determined that nucleotide sequences of amplified fragments of gene benA from the overall DNA of associations А1, А4 and А5, and from DNA of appropriate strains, had a higher level of similarity (78–99% at 96–100% overlapping) to the analogous gene of Gram-negative bacteria and a lower level of similarity with genes of BDO α­subunits of Gram-positive bacteria (79–87% at 83–97% overlapping) among over a thousand sequences presented in the database (http://blast.ncbi.nlm.nih.gov/).

Similar regularity was detected during analysis of similarity of nucleotide sequence of gene fragments amplified on the DNA of associations and bacterial strains obtained during cultivation on chlorobenzene (see Table 2, Fig. 1, 2). The level of similarity with the analogous dioxygenases of Gram-positive bacteria of classes Actinobacteria and Bacilli amounted to 83–88% at 73–100% overlapping; the level of similarity with the gene for the BDO α­subunit of Gram-negative bacteria of classes β­ and γ­Proteobacteria ranged from 80–99% at 85–100% overlapping.

Cluster analysis demonstrated that fragments of genes benA amplified with DNA of strains and associations extracted from the soils of Chapaevsk, at the 100% credible level, form the uniform cluster with the genes of BDO strains of the genus Pseudomonas (see Fig. 2). Thus, the obtained results do not preclude horizontal transfer of BDO genes among bacteria of different phylums. However, more probable is the hypothesis of a convergent origin of genes benA due to adaptation to similar effects of organochlorine compounds present in the environment, as well as in the cultivation medium [19–22].

As cluster analysis of amplified sequences and known nucleotide sequences of gene benA demonstrated that genes presented in the examined bacterial associations most likely form one cluster with BDO genes of the strains of genus Pseudomonas (see Fig. 2), further analysis was conducted inside the cluster (Fig. 3). The closest nucleotide sequence for gene benA amplified with DNA of associations А1, А4, А5, В1, В2, В3, В4, and В6 and of appropriate individual strains are the genes coding for the BDO α­subunit of strains of Pseudomonas putida KT2440 (GenBank LT799039.1) and Pseudomonas putida B6­2 (CP015202.1) — 96–99% of similarity at 100% overlapping. Analyzed genes form a separate cluster on the phylogenetic tree (see Fig. 3) adjacent to the cluster of gene benA of strains P. putida KT2440, P. putida B6­2 (GenBank CР015202.1), P. putida F1 (GenBank CР000712.1), P. putida SJTE‑1 (GenBank CР015876.1) and P. putida ND6 (GenBank CР003588.1). These results suggest that genes coding BDO α­subunit are spread in bacterial associations, which are well described for strains attributed to species Pseudomonas putida [9]. It is likely that genes of biodegradation can undergo horizontal transfer on plasmids between representatives of different phylums [19–21, 23].

The sequence of gene benA amplified with DNA of strain В5­170 of association В5 was placed in one cluster with genes of BDO strains of Pseudomonas sp. VLB120 and P. entomophila L48 (see Fig. 3), with the level of similarity of 93% at 100% overlapping, but in different clusters with gene benA of strain of Pseudomonas putida S16, despite that fact that the level of similarity with this gene in homologous search amounted to 95%. The strain from P. entomophila L48 (GenBank CT573326), pathogenic bacterium attributed to saprophytic soil aerobic bacteria, was detected to have enzymatic systems ensuring metabolism of benzoic, 4­hydroxybenzoic, 3­hyndoxybenzoic and 3,4­dihydroxybenzoic acids; in this strain, BDO is involved only in transformation of unsubstituted benzoic acid and genes are located on the primary chromosome [24]. A strain of Pseudomonas sp. VLB120 (GenBank CP003961) with BDO genes on the plasmid that is able to decompose octanol, toluene and styrene has been extracted from the soils of Stuttgart, Germany [25]. However, detection of the high similarity genes benA in spatially remote bacterial strains supports the theory of transfer of genetic material between bacteria of genus Pseudomonas in the process of adaptation to high level of contamination of aromatic and chlorine aromatic compounds [19, 21, 22].

In this research, fragments of the gene for the BDO α­subunit were detected to have unique nucleotide sequences; this is confirmed by the absence of 100% similarity with the sequences of the known genes benA placed in international databases. It was detected that the examined fragment of gene benA spread among bacterial strains of associations А1, А5 and В4 contains one substitution (cytosine is substituted with thymine). Two substitutions in the structure of nucleotides were detected in genes of the BDO α­subunit in associations А4, В3 and В6 (cytosine is substituted with thymine in all associations); in addition, adenine is substituted with cytosine (association А4), guanine is substituted with thymine (association В3) and guanine is substituted with adenine (association В6). The substitutions in nucleotides were detected in the fragments of gene benA spread in association В2, and six substitutions in nucleotides were detected in the sequence of fragments of gene benA in association В1. The greatest number of differences was detected in the nucleotide sequence of the examined fragment of gene α­subunit of BDO typical for association В5 (14 substitutions).

Detected spot mutations are not observed during analysis of the amino acid sequence of the fragment of the α­subunit of BDO in the representatives of associations А1, А5, В2, В4 and В6. One amino acid substitution was detected in the BDO sequence of associations А4 (serine is substituted with arginine) and В3 (aspartic acid is seen in the protein content instead of glutamic acid). Two amino acid substitutions were detected in the sequence of the examined enzyme typical for the strains of association В1 (tyrosine and alanine are substituted with serine). The greatest number of differences were detected in the amino acid sequence of the BDO α­subunit of association В5 — four substitutions (alanine is twice substituted with serine, lysine is substituted with glutamine, and asparagine is substituted with lysine). The current study did not examine whether the detected differences in nucleotide and amino acid sequences of the BDO α­subunit allowed the examined bacterial communities to more effectively use benzoate as the source of carbon and energy, in comparison with the well-known strains and their decomposition of aromatic compounds.

One of the adaptation mechanisms that allows aerobic bacteria to adapt to survival under stress conditions is mutations, including the spot mutations [26]. Mutations can also occur as a result of chemical compounds present in the bacteria surroundings. Bacterial associations examined in this work were affected by organochlorine compounds of the POP group for a long time, which can cause an increase in mutation frequency once they are present in the organism [4]. Probably, a combination of these factors resulted in the formation of unique sequences of genes of α­subunit of BDO among different types of bacterial communities available in the soils at the industrial site of SVJhZ JSC (Chapaevsk, Russia).

CONCLUSION

Genes determining α­subunits of benzoate dioxygenase were identified in bacterial associations exposed to long-term effects of organoaromatic pollutants under natural and artificial conditions. Amplified nucleotide sequences showed phylogenetic similarity with genes benA from strains of genus Pseudomonas, which perform destruction of different aromatic compounds.

Additional information

Research was conducted within the frame of the state task, state registration number of the subject: 01201353249.

 

Table 1

Bacterial associations obtained during storage cultivation

Cultivation substrate

Number of soil sample

Ch1

Ch2

Ch3

Ch4

Ch5

Ch6

4­chlorobenzoic acid

А1

А2

А3

А4

А5

А6

Chrolobenzene

В1

В2

В3

В4

В5

В6

 

Table 2

Comparison of nucleotide sequences of 16S rRNA of the isolated degradative strains of benzoate with homologous sequences of typical strains

Association

Strain

Typical strain

Similarity, %

А1

А1­69

Pseudomonas japonica NRBC103040T

99,9

А4

А4­72

Pseudomonas alcaligenes NBRC14159Т

100

А5

А5­67

Ochrobactrum anthropi ATCC49188T

99,8

А5­68

Pseudomonas alcaligenes NBRC14159Т

99,9

А5­70

Pseudomonas alcaligenes NBRC14159Т

100

В1

В1­169

Pseudomonas japonica NRBC103040T

99,9

В2

В2­174

Ochrobactrum anthropi ATCC49188T

99,5

В3

В3­162

Pseudomonas xanthomarina KMM 1447T

100

В3­163

Pseudomonas xanthomarina KMM 1447T

100

В3­164

Achromobacter spanius LMG 5911T

99,7

В3­165

Achromobacter spanius LMG 5911T

99,8

В3­166

Pseudomonas taiwanensis BCRC17751Т

100

В4

В4­172

Pseudomonas taiwanensis BCRC17751Т

99,9

В5

В5­167

Achromobacter spanius LMG 5911T

99,6

В5­168

Pseudomonas japonica NRBC103040T

100

В5­170

Pseudomonas alcaligenes NBRC14159Т

100

В5­172

Pseudomonas xanthomarina KMM 1447T

99,9

В6

В6­173

Ochrobactrum anthropi ATCC49188T

99,7

 

Table 3

Analysis of nucleotide sequences of the amplified fragments of gene benA

Association, fragment size, fp (number in GenBank)

Strain, size, fp (number in GenBank)

The closest homologous gene (number in GenBank)

Level of similarity, %

Overlapping, %

А1

419

(МК403888)

А1­69

420

(МК403897)

benA (α­subunit) Pseudomonas putida В6­2 (СР015202.1)

98

100

А4

415

(МК403889)

А4­72

416

(МК403898)

benA (α­subunit) Pseudomonas putida KT2440 (LT799039.1)

98

100

А5

420

(МК403890)

А5­67

423

(МК403899)

bedA (α­subunit) Pseudomonas putida JY­Q (CP011525.1)

benA (α­subunit) Pseudomonas putida KT2440 (LT799039.1)

99

 

98

100

 

100

В1

408

(МК403891)

В1­169

408

(МК403900)

bedA (α­subunit) Pseudomonas putida JY­Q (CP011525.1)

benA (α­subunit) Pseudomonas putida KT2440 (LT799039.1)

97

 

96

100

 

100

В2

398

(МК403892)

В2­174

395

(МК403901)

benA (α­subunit) Pseudomonas putida KT2440 (LT799039.1)

98

100

В3

399

(МК403893)

В3­164

399

(МК403902)

benA (α­subunit) Pseudomonas putida KT2440 (LT799039.1)

98

100

В4

401

(МК403894)

В4­172

403

(МК403903)

benA (α­subunit) Pseudomonas putida В6­2 (СР015202.1)

99

100

В5

400

(МК403895)

В5­170

401

(МК403904)

benA (α­subunit) Pseudomonas sp. VLB120 (CP003961.1)

benA (α­subunit) Pseudomonas putida S16

(CP002870.1)

93

 

95

100

 

99

В6

411

(МК403896)

В6­173

418

(МК403887)

benA (α­subunit) Pseudomonas putida KT2440 (LT799039.1)

97

100

 

Fig. 1. Electrophoregram of the amplification products of gene benA coding for α­subunit of benzoate dioxygenase with DNA bacterial associations. 1 — А1, 2 — А2, 3 — А3, 4 — А4, 5 — А5, 6 — А6, 7 — marker of molecular weight of O’GeneRulerTM 100bp Plus DNA Ladder (Fermentas, Lithuania), 8 — В1, 9 — В2, 10 — В3, 11 — В4, 12 — В5, 13 — В6, 14 — negative control

 

 

Fig. 2. Tree of similarity of the detected genes with the well-known genes of α­subunit of benzoate 1,2­dioxygenase constructed with method UPGMA. The scale corresponds to 10 nucleotide substitutions per every 100 nucleotides. Bootstrap­analysis was conducted using 1000 repeats. Values next to the branches demonstrate location of sequences in these groups. Bold fonts underline nucleotide sequences examined in the work. Designation of strains, as well as their generic and specific names are provided for the analyzed sequences

 

 

Fig. 3. Tree of similarity of nucleotide sequences homologous to the examined areas of genes of α­subunit of benzoate 1,2­dioxygenase of strains of genus Pseudomonas constructed with method UPGMA. The scale corresponds to 10 nucleotide substitutions per every 100 pairs of nucleotides. Bootstrap­analysis was conducted on 1000 repeats. Bold fonts underline nucleotide sequences examined in the work. Designation of strains, as well as their generic and specific names are provided for the analyzed sequences

 

Elmira A. Nazarova

«Институт экологии и генетики микроорганизмов Уральского отделения Российской академии наук» - филиал Федерального государственного бюджетного учреждения науки Пермского федерального исследовательского центра Уральского отделения Российской академии наук

Email: e9026309777@gmail.com

Russian Federation,  Goleva, 13, Perm, 614081

Postgraduate Student, Laboratory of Molecular Microbiology and Biotechnology

Tatyana D. Kiryanova

Perm State University

Email: kitadi@gmail.com

Russian Federation, Perm, 614990, Bukirev, 15.

Undergraduate, Biological Faculty

Daria O. Egorova

Federal State Budget Establishment of Science Institute of Ecology and Genetics of Microorganisms, Ural Branch of the Russian Academy of Sciences; Perm State University

Author for correspondence.
Email: daryao@rambler.ru
ORCID iD: 0000-0001-8018-4687
SPIN-code: 9450-7883
Scopus Author ID: 36622279600

Russian Federation, Perm, 614081, ul. Goleva, 13; Perm, Bukireva, 614990, 15. 

PhD (Biological Sciences), Associate Professor, Senior Researcher of the Laboratory of Molecular Microbiology and Biotechnology "IEGM UB RAS"

  1. Трегер Ю. СОЗ — стойкие и опасные // The Chemical Journal. – 2013. – № 1. – С. 30–34. [Treger U. POPs – persistent and dangerous. The Chemical Journal. 2013(1):30-34. (In Russ.)]
  2. Назаров А.В., Егорова Д.О., Макаренко А.А., и др. Эколого-микробиологическая оценка грунтов, загрязненных полихлорированными бифенилами // Экология человека. – 2016. – № 3. – С. 3–8. [Nazarov AV, Egorova DO, Makarenko AA, et al. Ecological-microbiological assessment of polychlorinated biphenyl-contaminated grounds. Ecology Human. 2016;(3):3-8. (In Russ.)]
  3. Revich B, Shelepchikov A. Persistent organic pollutants (POPs) hot spots in Russia. In: Mehmetli E, Koumanova B. The fate of persistent organic pollutants in the environment. NATO science for peace and security series. Springer, Dordrecht; 2008. P. 113-126. https://doi.org/10. 1007/978-1-4020-6642-9_9.
  4. Final act of the Conference of Plenipotentiaries on the Stockholm convention on persistent organic pollutants, Stockholm, 22-23 May / UNEP/POPS/CONF/4. United Nations Environment Programme. Geneva; 2001. 44 р.
  5. Соляникова И.П., Борзова Щ.В., Емельянова Е.В., и др. Диоксигеназы, индуцирующиеся при разложении бензоата деструкторами хлорбифенилов Rhodococcus wratislaviensis G10 и хлорфенолов Rhodococcus opacus 1CP, и гены, потенциально вовлеченные в этот процесс // Биохимия. – 2016. – Т. 81. – № 9. – С. 1239–1253. [Solyanikova IP, Borzova OV, Emelyanova EV, et al. Dioxygenases of chlorobiphenil-degrading species Rhodococcus wratislaviensis G10 and chlorophenol-degrading species Rhodococcus opacus 1CP induced in benzoate-grown cells and genes potentially involved in these processes. Biochemistry (Moscow). 2016;81(9):986-998. (In Russ.)]. https://doi.org/10. 1134/S000629791609008X.
  6. Field JA, Sierra-Alvarez R. Microbial transformation of chlorinated benzoates. Rev Environ Sci Bio Technol. 2008;7(3):191-210. https://doi.org/10. 1007/s11157-008-9133-z.
  7. Dalvi S, Youssef NH, Fathepure BZ. Microbial community structure analysis of a benzoate-degrading halofilic archeal enrichment. Extremophiles. 2016;20(3):311-321. https://doi.org/10. 1007/s00792-016-0823-0.
  8. Parales RE, Resnick SM. Aromatic ring hydroxylating dioxygenases. Pseudomonas. 2006;4:287-340. https://doi.org/10. 1007/0-387-28881-3_9.
  9. Kahlon RS. Pseudomonas: molekular and applied biology. Springer International Publishing Switzerland; 2016. 519 р. https://doi.org/10. 1007/978-3-319-31198-2.
  10. Solyanikova IP, Emelyanova EV, Shumkova ES, et al. Pecularities of the degradation of benzoate and its chloro- and hydraxy-substituted analogs by Actinobacteria. Int Biodeter Biodegrad. 2015;100:155-164. https://doi.org/10. 1016/j.ibiod.2015. 02. 028.
  11. Zhan Y, Yu H, Yan Y, et al. Genes involved in the benzoate catabolic pathway in Acinetobacter calcoaceticus PHEA-2. Curr Microbiol. 2008;57(6):609-614. https://doi.org/10. 1007/s00284-008-9251-4.
  12. Зайцев Г.М., Карасевич Ю.Н. Подготовительный метаболизм 4-хлорбензойной кислоты у Arthrobacter globiformis // Микробиология. – 1981. – Т. 50. – № 2. – С. 423–428. [Zaitsev GM, Karasevich YuN. Preparatory metabolism of 4-chlorobenzoic acid in Arthrobacter globiformis. Microbiology. 1981;50(2):423-428. (In Russ.)]
  13. .Ausbel FM, Brent R, Kingston RE, et al. Short protocols in molecular biology. 3rd ed. New York: John Wiley & Sons; 1995. 450 р.
  14. Методы общей бактериологии. В 3 т. / Под ред. Ф. Герхардта и др.; пер. с англ. под ред. Е.Н. Кондратьевой, Л.В. Калакуцкого. – М.: Мир, 1983–1984. [Methods for general and molecular bacteriology. V 3 t. Ed. by Ph. Gerhardt et al., translated from English E.N. Kondrat’eva, L.V. Kalakutskij. Moscow: Mir; 1983-1984. (In Russ.)]
  15. Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol. 1991;173(2):697-703. https://doi.org/10. 1128/jb.173. 2. 697-703. 1991.
  16. Baggi G, Bernasconi S, Zangarossi M, et al. Co-metabolism of di- and trichlorobenzoates in a 2-chlorobenzoate-degrading bacterial culture: Effect of the position and number of halo-substituents. Int Biodeter Biodegrad. 2008;62(1):57-64. https://doi.org/10. 1016/j.ibiod.2007. 12. 002.
  17. Benning MM, Wesenberg G, Liu RQ, et al. The three-dementional structure of 4-hydroxybensoyl-CoA thioesterase from Pseudomonas sp. Strain CBS-3. J Biol Chem. 1998;273(50):33572-33579. https://doi.org/10. 1074/jbc.273. 50. 33572.
  18. Kobayashi K, Katayama-Hirayama K, Tobita S. Hydrolytic dehalogenation pf 4-chlorobenzoic acid by an Acinetobacter sp. J Gen Appl Microbiol. 1997;43(2):105-8. https://doi.org/10. 2323/jgam.43. 105.
  19. Coleman ML, Chisholm SW. Ecosystem-specific selection pressures revealed through comparative population genomics. Proc Natl Acad Sci USA. 2010;107(43): 18634-9. https://doi.org/10. 1073/pnas.1009480107.
  20. Dunning Hotopp JC. Horizontal gene transfer between bacterial and animals. Trends Genet. 2011;27(4):157-163. https://doi.org/10. 1016/j.tig.2011. 01. 005.
  21. Syvanen M. Evolutionary implications of horizontal gene transfer. Annu Rev Genet. 2012;46:341-358. https://doi.org/10. 1146/annurev-genet-110711-155529.
  22. Polz MF, Alm EJ, Hanage WP. Horizontal gene transfer and the evolution of bacterial and archaeal population structure. Trends Genet. 2013;29(3):170-175. https://doi.org/10. 1016/j.tig.2012. 12. 006.
  23. Li D, Yan Y, Ping S, et al. Genom-wide investigation and functional characterization of the β-ketoadipate pathway in the nitrogen-fixing and root-associated bacterium Pseudomonas stutzeri A1501. BMC Microbiol. 2010;10(1):36. http://www.biomedcentral.com/1471-2180/10/36.
  24. Vodovar N, Vallenet D, Cruveiller S, et al. Complete genome sequence of the entomopathogenic and metabolically versatile soil bacterium Pseudomonas entomophila. Nature Biotechnology. 2006;24(6):673-679. https://doi.org/10. 1038/nbt1212.
  25. Köhler KA, Rückert C, Schatschneider S, et al. Complete genome sequence of Pseudomonas sp. Strain VLB120 a solvent tolerant, styrene degrading bacterium, isolated from forest soil. J Biotechnol. 2013;168(4):729-730. https://doi.org/10. 1016/j.jbiotec.2013. 10. 016.
  26. Liang B, Jiang JD, Zhang J, et al. Horizontal transfer of dehalogenase genes involved in the catalysis of chlorinated compounds: evidence and ecological role. Crit Rev Microbiol. 2012;38(2):95-110. https://doi.org/ 10. 3109/1040841x.2011. 618114.

Supplementary files

There are no supplementary files to display.

Views

Abstract - 56

PDF (Russian) - 52

PDF (English) - 0

Cited-By


PlumX


Copyright (c) 2019 Nazarova E.A., Kiryanova T.D., Egorova D.O.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies