Sinorhizobium meliloti: chromosomal types and genomic islands

Cover Page

Abstract


Background. Polymorphism analysis was done for the core genome sequences of nodule bacteria of S. meliloti species in order to identify chromosomal types and to evaluate the occurrence of accessory elements (genomic islands) in them.

Materials and methods. Chromosomal studied loci were: betBC (marker M-I) and SMc04407-SMc04881 (marker M-II) both are related to metabolic processes and stress tolerance, and 16S-23S intergenic sequences (marker M-III) to search phylogenetical distance at intraspecies level.

Results. Significant differences between the occurrence of alleles of gene-markers M-I/M-II and MIII were determined between strains related to tested the 5 typical groups and 9 subgroups of strains differing by geographical region/source (nodule, soil) of isolation, as well as by salt tolerance. Four chromosomal types were identified among tested S. meliloti native isolates and a preference occurence of one of the three islands Rm1021 in links with particular chromosomal type was shown. The significant prevalence of strains with particular chromosomal type was shown for S. meliloti populations native to centers of alfalfa diversity at the NE of Caucasus, as well as at NE of Kazakhstan (Aral sea related region), as well as in agrocenoses. Conclusion. It was predicted that strains inherited altered markers M-I/M-II may belong to divergent clonal lines occured in both centers of alfalfa diversity, while strains with altered sequences of all three markers could be a representatives of a new S. meliloti biovar(s), the formation of which is occurred much more intensively at the modern center of the introgressive hybridization of alfalfa at NE of Kazakhstan.


ВВЕДЕНИЕ

Геном клубеньковых бактерий (ризобии) включает хромосому и плазмиды, значительно различающиеся по размеру. Наличие нескольких репликонов в геноме (многокомпонентность) может быть обусловлено тем, что ризобии не только являются типичными почвенными сапрофитами, но и вступают в необлигатный азотфиксирующий симбиоз с бобовыми растениями, в процессе формирования которого клетки бактерий претерпевают необратимые морфофизиологические и метаболические изменения в микроаэрофильных и гиперосмотических условиях клубенька.

Гены, расположенные на хромосоме бактерий, детерминируют жизненно важные процессы, и их рассматривают как гены «домашнего хозяйства», или базовые, или коровые (от англ. core) [1–7]. Ортологи этих генов присутствуют, как правило, у всех штаммов одного вида/рода, а также у соответствующих им предполагаемых общих предков [8, 9]. Изучение структуры генов у генетически неродственных штаммов бактерий на рестрикционном (полиморфизм длин рестрикционных фрагментов — ПДРФ) и/или нуклеотидном уровнях позволяет выявлять аллели с разным уровнем сходства, на основании которого штаммы объединяют в группы/кластеры [4, 9–11]. Хромосомы штаммов из контрастно различающихся кластеров или групп описывают как разные хромосомные линии (англ. chromosomal lineages) [4, 10, 11], или группы (англ. chromosomal groups) [12], или генотипы (англ. chromosomal genotypes) [10, 13], или типы (англ. chromosomal types) [10, 11, 14, 15]. Необходимо отметить, что вплоть до настоящего времени нет общепринятого обозначения, и даже в одной публикации несколько из вышеперечисленных терминов могут как синонимы встречаться одновременно [4, 10, 11, 16]. В данной работе использован термин «хромосомные типы».

Важным условием отбора генов-маркеров для определения хромосомных типов является низкий уровень структурного полиморфизма генов-кандидатов и отсутствие (или низкий уровень) рекомбинации между ними [10], кроме того, они должны быть ортологами [17]. Анализ литературных данных показал, что в качестве генов-маркеров используют rrs (16S рДНК), rrl (23S рДНК), atpD (ATФ-синтаза), glnII (глутаминсинтетаза), recA (белок, участвующий в процессе рекомбинации и репарации) или zwf (глюкозо-6-фосфатдегидрогеназа), sod (супероксиддисмутаза), lacZ (β-галактозидаза) или SMc00019 (консервативный гипотетический белок), truA (тРНК-псевдоуридинсинтаза A), thrA (гомосериндегидрогеназа) [10, 11, 18, 19]. Авторы преимущественно анализировали два, реже три коровых гена из указанного списка, однако известны работы, в которых использовали один ген-маркер, например, gyrB (β-субъединица ДНК-гиразы) [4] или dnaJ (или Hsp40; белок теплового шока размером 40 кДа) [20]. Нами был проведен анализ продуктов вышеперечисленных генов с применением базы данных кластеров групп белков-ортологов (англ. Cluster of Orthologous Groups, или COG-группы) [17]. Как оказалось, вышеуказанные гены кодируют белки, входящие в восемь из двадцати пяти известных COG-групп, относящихся к трем из четырех COG-кластеров. Один из указанных кластеров включает гены, продукты которых участвуют в процессах хранения и обработки информации (группы L, J, K), второй кластер — в процессах метаболизма (группы C, E, G, P) и третий кластер — в клеточных процессах и сигналинге (группа O). Известны случаи, когда помимо коровых генов для выявления хромосомных типов использовали не кодирующую белки межгенную последовательность rrs-rrl рибосомального оперона (англ. Intergenic Transcribed Spacer, ITS) [4, 13, 20, 21]. Однако анализ ITS преимущественно применяют в филогенетических исследованиях бактерий на внутривидовом уровне [18, 20–23], поскольку это позволяет выявлять новые филогенетически обособленные кластеры штаммов (линии/биовары/подвиды; англ. lineages/biovars/subspecies) [21, 24, 25].

Заслуживает внимания работа Escobar-Páramo et al. (2004), в которой сделано предположение, что штаммы Escherichia coli с разными хромосомными типами содержат разные факторы вирулентности [26]. Последние относят к дополнительным, или акцессорным (англ. accessory), элементам генома, поскольку они присутствуют не у всех штаммов одного вида [2]. Акцессорными элементами являются плазмиды, геномные островки и геномные острова, которые рассматривают как генетические элементы вспомогательного (англ. auxiliary), или гибкого (англ. flexible) [3, 5, 27, 28], или акцессорного, генома (последний термин получил наибольшее распространение в современной англо- и русскоязычной литературе) [1, 4, 5, 7, 27, 28]. Как правило, гены акцессорной части генома не вовлечены в контроль жизненно важных функций клетки, но могут детерминировать процессы, предопределяющие способность бактерий занимать разные экологические ниши [29, 30]. Из акцессорных элементов наибольший интерес представляют геномные острова (ГО) — протяженные последовательности (до 700 т. п. н.) фагового происхождения, сайт-специфически встраивающиеся в последовательности генов, кодирующих тРНК [31]. Геномные острова характеризуются пониженным содержанием пар гуанина и цитозина (в среднем до 12 %) относительно коровой части хромосомы [31, 32]. Наличие последовательностей с менее жесткой структурной организацией (за счет обогащения их двойными водородными связями между аденином и тимином) может влиять на стабильность структуры хромосомы и активность генов [33]. Геномные острова содержат мобильные генетические элементы разных классов и открытые рамки считывания. Функциональный анализ гипотетических продуктов этих открытых рамок считывания показал, что они являются паралогами и/или ортологами различных по функциональной значимости генов, которые гомологичны таковым у бактерий из разных фил [28]. Это доказывает, что ГО участвует в процессах отдаленного горизонтального переноса генов. Показано, что штаммы даже одного вида могут значительно различаться по наличию ГО [34–36], однако для клубеньковых бактерий нет данных о зависимости встречаемости ГО от характеристик корового генома.

В хромосоме референс-штамма Sinorhizobium meliloti Rm1021, являющегося симбионтом люцерны, выявлено три протяженные последовательности (от 19 до 80 т. п. н), которые соответствуют характеристикам ГО согласно базе данных Islander [37]. Cмежные ГО (Sme21T и Sme19T) обладают сходной протяженностью и расположены в первой четверти хромосомы, тогда как третий геномный остров (Sme80S) находится в последней четверти хромосомы и существенно превосходит в длину оба вышеуказанных острова (рис. 1) [28]. В составе Sme80S присутствуют копии генов, имеющих отношение к симбиотической активности и процессам метаболизма осмопротекторов [36]. Выявлены достоверные различия по встречаемости Sme80S и Sme21T у штаммов S. meliloti, адаптированных к засоленным и засушливым почвам соответственно [28].

Цель работы заключалась в изучении полиморфизма хромосомных последовательностей для выявления хромосомных типов и в оценке встречаемости в них ГО (рассматриваемых в качестве акцессорных элементов хромосомы) в геномах природных штаммов клубеньковых бактерий S. meliloti, различавшихся по району и источнику выделения (очаги разнообразия генцентров бобовых растений и агроценозы; клубенек и почва) и по фенотипу (солеустойчивые и солечувствительные).

МАТЕРИАЛЫ И МЕТОДЫ

Штаммы. Изучено 218 природных штаммов Sinorhizobium meliloti из рабочей коллекции штаммов клубеньковых бактерий лаборатории генетики и селекции микроорганизмов ФГБНУ ВНИИСХМ. Штаммы выделены из клубеньков растений-хозяев и из почв (далее К- и П-изоляты соответственно), собранных на территории северной части Кавказского генцентра культурных растений (далее СКГ) и в северном районе Приаралья (Казахстан), относящегося к современному центру интрагрессивной гибридизации люцерны (далее ПАГ), а также из почв агроценозов (далее АЦ) Ленинградской области Северо-Западного региона РФ, с использованием соответствующих методик [38]. Для выделения штаммов из почв применяли метод «трэппинга» (англ. trapping), согласно которому стерильные проростки растений инокулировали почвенными вытяжками [38]. Всего проанализировано 95 и 89 штаммов S. meliloti из СКГ и ПАГ, представленных К- и П-изолятами (31/64 и 66/23 соответственно) и 34 П-изолята из АЦ. Принадлежность штаммов из СКГ и ПАГ к виду S. meliloti была определена ранее [39], а штаммов из АЦ — в настоящем исследовании с помощью метода ARDRA. В качестве референса использовали штамм S. meliloti Rm1021.

Солеустойчивость штаммов определяли по росту штаммов на среде TY, содержащей 0,6 М NaCl, согласно методу, описанному в работе [38]. Штаммы из СКГ и ПАГ имели солеустойчивый (нормальный рост; далее R) или солечувствительный фенотип (слабый рост; далее S) [40]. Солеустойчивость изолятов из АЦ определена в настоящей работе. Соотношения R/S штаммов в популяциях из СКГ, ПАГ и в группе штаммов из АЦ были следующими: 74/21, 49/40 и 31/3 соответственно.

Маркерные последовательности хромосомы определены в соответствии с полногеномной последовательностью референс-штамма S. meliloti Rm1021 (GenBank NC_003047. 1; см. рис. ١). Маркер М-I — последовательность протяженностью 1544 п. н., включавшая последовательность 3’-конца гена betB (143 п. н.), последовательность 5’-конца гена betC (1400 п. н.), 1 п. н. между генами betC и betB. Гены betBC, расположенные во второй четверти хромосомы, вовлечены в процессы формирования солеустойчивого фенотипа, а также в метаболизм углерода и азота (см. рис. 1). Маркер М-II — локус msfp, находящийся в последней четверти хромосомы в непосредственной близости от oriC (см. рис. 1). В состав анализируемой последовательности msfp, протяженностью 1280 п. н., входили последовательность 5’-конца гена SMc04407 (532 п. н.), последовательность между генами SMc04407 и SMc04881 (518 п. н.) и последовательность 3’-конца гена SMc04881 (230 п. н.). Продуктом первого гена является белок, предположительно участвующий в транспорте осмопротектора (пролина/бетаина), а продукт второго гена вовлечен в синтез гомолога токсина VapC-системы токсин — антитоксин II типа и в формирование состояния покоя бактериальной клетки в условиях стресса [41]. Поскольку маркеры М-I и M-II задействованы в процессах метаболизма и формирования стрессоустойчивости, далее они обозначены как «метаболические маркеры».

 

Рис. 1. Схема локализации коровых маркерных последовательностей и геномных островов на хромосоме референс-штамма Sinorhizobium meliloti Rm1021: oriC — ориджин репликации; — коровые маркеры; rrn (1-3) — рибосомальные опероны, содержащие ITS-последовательности; — геномные острова

 

Маркер М-III — межгенная последовательность ITS (IGS rrs-rrl; см. рис. 1) оперона рибосомальных генов (rrs-rrl) протяженностью 1308 п. н., включавшая 3’-конец последовательности гена 16S рРНК (21 п. н.), последовательность между генами 16S рРНК и тРНКИле (256 п. н.), последовательность гена тРНКИле (77 п. н.), последовательность между генами тРНКИле и тРНКАла (139 п. н.), последовательность гена тРНКАла (76 п. н.), последовательность между генами тРНКАла и 23S рРНК (607 п. н.) и 5’-конец последовательности гена 23S рРНК (131 п. н.). Анализ последовательности маркера М-III использован в филогенетических исследованиях бактерий на внутривидовом уровне и далее обозначен как «филогенетический маркер».

Анализ белковых продуктов генов-маркеров М-I, М-II показал, что они относились к тем же COG-группам (C, E, G, P, R), что и приведенные выше маркеры, с помощью которых определяли хромосомные типы у штаммов бактерий [4, 10, 11, 18–20].

ПЦР-анализ проводили с целью генотипирования штаммов. Рестрикционные профили ПЦР амплифицированных последовательностей (ПЦР-ПДРФ), полученные для каждого из изученных штаммов, рассматривали как ПДРФ-типы или аллели, согласно работам [42, 43]. ПЦР-анализ выполняли с применением соответствующих пар праймеров для указанных маркерных последовательностей: М-I (betBC) [44], М-II (msfp; MSFp-F: CACCAGCGAGAGGAAGAGAC, MSFp-R: GAAACCCTGCGTTTGTTGAT), М-III (ITS) [39]. ПЦР осуществляли в 20 мкл смеси для амплификации, содержащей 25 мМ MgCl2, 1,5 ед. акт. Taq ДНК-полимеразы (ЕврогенТМ PK113L), при pH 9,1 в термоциклере C1000™ Thermal Cycler (Bio-Rad, США). Температура отжига праймеров — 55 °C (30 циклов реакции). В качестве матрицы использовали общую ДНК штаммов, выделенную стандартным методом фенол-хлороформной экстракции из клеточных лизатов [45]. Продукты амплификации обрабатывали раздельно эндонуклеазами MspI и HaeIII в случае маркеров M-I и M-III и эндонуклеазой EcoRI в случае M-II (Thermo Fisher ScientificТМ ER0541, ER0151 и ER0271 соответственно). Рестрикцию проводили в стандартных условиях согласно протоколам Thermo Fisher Scientific (температура — 37 °C, время — 2 ч). Электрофоретическое разделение полученных фрагментов выполняли в 3 % агарозном геле в 0,5 кратном буфере TAE.

В результате для каждого штамма были получены профили ПЦР-ПДРФ (далее ПДРФ-типы) для каждого из указанных маркеров. ПДРФ-типы, сходные с таковыми референс-штамма, обозначали как тип «а», тогда как отличные от них, то есть дивергентные, иными буквами латинского алфавита, например, тип «b» или «c» и т. д.

Наличие ГО определяли методом ПЦР с использованием оригинальных пар праймеров на внешние пограничные участки [36]. ДНК штамма Rm1021, содержавшего три острова (Sme19T, Sme21T и Sme80S), и штамма СХМ1-105, в геноме которого нет островов, использовали в качестве контроля в экспериментах по выявлению ГО в геномах штаммов согласно работе [31].

Статистическую обработку данных осуществляли с помощью программного пакета PAST [46]: критерий χ2 при α = 0,05 (df число степеней свободы), индекс гетерогенности Шеннона (H) и индекс выравненности (E). Индекс Нея вычисляли по формуле N = (1 – – ∑(Pi2)) ∙ (n/(n – 1)), где Pi — частота i-го генотипа, n — общее число выявленных генотипов [47]. Неравновесие по сцеплению (LD) рассчитывали с использованием программы Arlequin ver 3. 5 (2010) [48].

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Проанализирована выборка из 218 природных штаммов Sinorhizobium meliloti, выделенных из географически изолированных районов (генцентры СКГ и ПАГ и агроценозы АЦ) и разных источников (К- и П-изоляты). Анализ выборок К-изолятов из СКГ и ПАГ продемонстрировал, что преимущественно со сходными частотами они имели R-фенотип (средняя частота — 0,68). R-фенотип был также присущ подавляющему большинству П-изолятов из СКГ и АЦ (частоты 0,80 и 0,91 соответственно), тогда как S-фенотип — для П-изолятов из ПАГ (частота 0,65). Между указанными группами П-изолятов различия были достоверны (χ2паг/скг = 15,6; p = 7,7·10–5; df = 1; χ2ПАГ/АЦ = 20,2; p = 7,0 · 10–6; df = 1). Достоверные различия по встречаемости штаммов, контрастно различавшихся по фенотипу, показаны для групп К- и П-изолятов из ПАГ (χ2 = 5,15; p = 2,3 · 10–2; df = 1), но не выявлены для аналогичных групп из СКГ.

Согласно полученным данным было сформировано пять типических групп изолятов, различавшихся по районам (СКГ, ПАГ, АЦ) и источникам выделения (К и П), из которых каждая соответственно включала две подгруппы штаммов R- или S-фенотипа, то есть всего 10 подгрупп (рис. 2). Поскольку подгруппа П-изолятов S-фенотипа из АЦ была крайне малочисленной (три штамма; частота в группе 0,09; см. рис. 2), то ее не учитывали в сравнительном статистическом анализе.

Полиморфизм последовательностей маркеров М-I и М-II изучали в указанных выше типических группах и подгруппах природных штаммов S. meliloti (см. рис. 2). Были определены ПДРФ-типы последовательностей маркеров М-I и М-II, сходные с таковыми у референс-штамма (далее референс-тип или аллель «а»), а также отличные от них (далее дивергентные типы или аллели). В случае маркера М-I выявлено пять, а в случае М-II — четыре дивергентные аллели, то есть соответствующие маркерные последовательности имели структурные изменения относительно референса. Значения индексов гетерогенности рассчитывали исходя из встречаемости референс- и дивергентных аллелей маркеров M-I и М-II, которые составили для изучаемой выборки штаммов 0,89 и 0,97 соответственно.

 

Рис. 2. Встречаемость ПДРФ-типов маркеров M-I (а), M-II (б) и M-III (в) у штаммов S. meliloti: а, b, c, w, z — ПДРФ-типы, х — группа, объединяющая уникальные дивергентные ПДРФ-типы; R — штаммы солеустойчивого фенотипа; S — штаммы солечувствительного фенотипа; К — штаммы, выделенные из клубеньков; П — штаммы, выделенные из почв; СКГ — Кавказский генцентр; ПАГ — Приаральский центр разнообразия люцерн; АЦ — агроценозы

 

Референс-аллели маркеров M-I и M-II встречались чаще в обеих подгруппах П-изолятов из СКГ и в подгруппе солечувствительных П-изолятов из ПАГ (см. рис. 2, а, б). В указанных подгруппах штаммов частоты встречаемости этих аллелей по каждому маркеру были сходными или равными: 0,84; 0,69 и 0,9 соответственно (см. рис. 2, а, б). Однако в двух случаях — у солеустойчивых П-изолятов из ПАГ и АЦ — частоты встречаемости референс-аллелей M-I или M-II были низкими, при этом равными или сходными (0,13 и 0,27 соответственно; см. рис. 2, а, б). Достоверные различия выявлены между подгруппами П-изолятов из ПАГ (χ2 = 12,0; p = 5,2 · 10–4, df = 1 и χ2 = 15,0; p = 1,1 · 10–4; df = 1 соответственно для M-I и M-II). Анализ групп К-изолятов показал, что референс-аллель M-I встречалась со сходными частотами в обеих подгруппах штаммов из СКГ и в подгруппе солеустойчивых К-изолятов из ПАГ (средняя частота — 0,52), тогда как в подгруппе солечувствительных штаммов эту же аллель идентифицировали реже (0,44; см. рис. 2, а). Интересно, что референс-аллель M-II чаще выявляли у солеустойчивых, чем у солечувствительных, К-изолятов как в случае СКГ, так и в случае ПАГ (в 1,3 и 1,3 раза соответственно), однако различия не достоверны (см. рис. 2, б). В результате сравнительного анализа групп К- и П-изолятов было установлено, что референс-аллели M-I и M-II достоверно чаще встречались у П-изолятов СКГ (имевших преимущественно солеустойчивый фенотип) и К-изолятов ПАГ (χ2 = 25,3; p = 4,8 · 10–7; df = 1; χ2 = 24,1; p = 9,2 · 10–7; df = 1 соответственно).

Дивергентные аллели «b» М-I и «с» М-II выявлены почти во всех подгруппах штаммов, за неполным исключением П-изолятов из ПАГ (см. рис. 2, а, б). В случае П-изолятов из СКГ обе аллели встречались более чем у четверти штаммов солечувствительного фенотипа, тогда как у солеустойчивых изолятов в 2–3 раза реже (см. рис. 2, а, б). Интересно, что аллель «b» М-I была доминирующей у солеустойчивых П-изолятов из АЦ (частота — 0,74), тогда как аллель «с» М-II встречалась вдвое реже (см. рис. 2, а, б). Обе дивергентные аллели также идентифицированы у К-изолятов из ПАГ и СКГ, причем частоты встречаемости были сопоставимы с таковыми для соответствующих референс-аллелей (χ2 = 0,68; p = 0,9; df = 3). Кроме того, аллель «с» М-II идентифицировали чаще в подгруппах К-изолятов солечувствительного фенотипа в СКГ, а также в ПАГ, различия не достоверны (p > 0,5; см. рис. 2, а, б). Однако в группах К-изолятов из СКГ и ПАГ аллели «b» М-I и «с» М-II встречались достоверно чаще, чем в соответствующих группах П-изолятов (χ2 = 12,2; p = 6,9 ∙ 10–3; df = 3; χ2 = 8,7; p = 3,3 ∙ 10–2; df = 3 соответственно).

Следует также рассмотреть распространенность дивергентных аллелей «z» М-I и «w» М-II, из которых первая встречалась у единичных К- и П-изолятов ПАГ, а вторая — у единичных солеустойчивых и солечувствительных П-изолятов СКГ и ПАГ соответственно. Исключение составили обе подгруппы К-изолятов (средняя частота — 0,19) и подгруппа солеустойчивых П-изолятов из ПАГ. В последнем случае обе аллели встречались у подавляющего числа штаммов (частота — 0,88; см. рис. 2, а, б).

Помимо рассмотренных четырех типов дивергентных аллелей маркеров» М-I и М-II идентифицированы уникальные дивергентные аллели у единичных штаммов, которые были объединены в группы «х» (см. рис. 2, а, б). Указанные штаммы, имевшие уникальные типы маркера М-I, обнаружены в обеих подгруппах К-изолятов ПАГ, а также у солечувствительных П-изолятов СКГ. Уникальные типы маркера М-II встречались только в подгруппах солеустойчивых К-изолятов ПАГ и СКГ. Значения χ2 для всех групп штаммов по рассмотренным аллелям маркеров М-I и М-II приведены в Приложении, табл. 1.

Таким образом, анализ маркерных последовательностей М-I и М-II, содержащих гены, продукты которых вовлечены в процессы метаболизма и в формирование стрессоустойчивости (в частности, устойчивость к условиям засоления), продемонстрировал, что почвенные изоляты из разных географических районов наследовали преимущественно аллели, сходные с референсом. Исключение составили две подгруппы: П-изоляты солеустойчивого фенотипа из ПАГ и АЦ, у которых со сходными частотами доминировали дивергентные аллели маркера М-I, а также М-II. Группы К-изолятов из СКГ и ПАГ были существенно разнообразнее, чем П-изоляты, вследствие того что частоты встречаемости дивергентных аллелей М-I и М-II были выше и сопоставимы с таковыми для соответствующих референс-аллелей. Полученные данные позволили заключить, что увеличение генотипического разнообразия (диверсификация) штаммов, выделенных из почв (метод трэппинга, см. «Материалы и методы»), происходит в генцентрах и агроценозах, по-видимому, под влиянием дизруптивного частотозависимого отбора, а генотипическое разнообразие штаммов, выделенных из клубеньков, — под действием стабилизирующего частотозависимого отбора, что согласуется с работами [49, 50]. Кроме того, среди П-изолятов солеустойчивого фенотипа из ПАГ и АЦ доминируют штаммы с измененными метаболическими маркерами по отношению к референсу, которые могут относиться к клональным линиям.

Полиморфизм маркерной последовательности М-III. Референс-штамм Rm1021 содержит три идентичные ITS-последовательности согласно GenBank NC_003047. 1, которые имеют один ПДРФ-профиль, далее тип «а» маркера М-III (см. «Материалы и методы»; рис. 1). В результате анализа таковых последовательностей у природных штаммов идентифицировано, помимо референс-типа «а», 16 дивергентных типов маркера М-III, что указывало на структурные различия соответствующих ITS-последовательностей в рибосомальных оперонах изолятов согласно работе [39]. Определен индекс гетерогенности для всей выборки из 218 штаммов по маркеру М-III (Н = 1,38), значение которого было существенно выше таковых для рассмотренных выше маркеров M-I и М-II (0,89 и 0,97). Анализ штаммов из СКГ и ПАГ показал, что значение индекса гетерогенности для последнего в 2,4 раза выше (1,51 и 0,63 соответственно). Кроме того, значения Н были сходными в случае групп К- и П-изолятов из СКГ (0,52 и 0,62 соответственно), но были в 1,5 раза выше для К-, чем для П-изолятов из ПАГ (1,55 и 1,06 соответственно). Приведенные значения индекса Н позволяют предположить, что популяция штаммов из ПАГ более разнообразна по филогенетическому маркеру и в ней могут происходить процессы, направленные на обособление новых биоваров клубеньковых бактерий люцерны.

Тип «а» М-III был доминирующим/преобладающим во всех подгруппах штаммов, но встречался достоверно чаще (в среднем в 1,4 раза) в популяции СКГ, чем в ПАГ (χ2 = 27,2; p = 5,5 ∙ 10–6; df = 3), и преимущественно у ризобий солеустойчивого фенотипа. Вместе с тем между подгруппами К- и П-изолятов из изучаемых генцентров достоверных различий не установлено (p > 0,05; см. рис. 2, в). Референс-тип был доминирующим у П-изолятов из АЦ (частота — 0,97; см. рис. 2, в).

Дивергентный тип «b» маркера М-III был вторым по частоте встречаемости во всех подгруппах штаммов, за неполным исключением П-изолятов из АЦ, у которых он выявлен только в случае единичного солечувствительного штамма. У штаммов из СКГ тип «b» М-III встречался со сходными частотами у солечувствительных К- и П-изолятов (средняя частота — 0,14), но в 1,4 раза чаще у солеустойчивых П-изолятов и крайне редко у К-изолятов этого же фенотипа (см. рис. 2, в). У штаммов из ПАГ указанный тип преимущественно выявлен у К-изолятов R-фенотипа (частота — 0,17) и только у единичных штаммов S-фенотипа (см. рис. 2, в). С наибольшей частотой тип «b» маркера М-III идентифицирован у солечувствительных П-изолятов из ПАГ (частота — 0,33), тогда как у солеустойчивых штаммов он встречался в 2,5 раза реже (см. рис. 2, в). Географически изолированными популяциями штаммов из рассматриваемых генцентров достоверно различались по встречаемости типовых и дивергентных последовательностей маркера М-III (χ2 = 15,4; p = 4,5 ∙ 10–4; df = 2).

Остальные 15 дивергентных типов являлись уникальными и были идентифицированы у одного-трех штаммов. Подавляющее большинство уникальных типов (13 из 15) отмечено в подгруппе К-изолятов и в подгруппе солеустойчивых П-изолятов из ПАГ (средняя частота — 0,27; см. рис. 2, в). Штаммы, имевшие указанные уникальные типы маркера М-III, были объединены в соответствующие группы «х» (см. рис. 2, в), которые далее не рассматривали.

Таким образом, установлено преобладание дивергентных последовательностей маркера М-III у штаммов из ПАГ по сравнению со штаммами из других генцентров, а также из агроценозов. Полученные результаты согласуются с ранее опубликованными нами данными [39, 51, 52] и свидетельствуют о том, что в популяции ризобий, адаптированных к условиям экстремального засоления, активно происходят процессы диверсификации штаммов, возможно направленные на формирование нового биовара клубеньковых бактерий люцерны.

Анализ сочетаний хромосомных маркерных последовательностей. Попарный анализ сочетаний референс- и дивергентных последовательностей маркеров М-I, М-II и М-III был проведен с целью выявления неравновесия по сцеплению (Linkage disequilibrium, LD). В результате таковое было определено между маркерами М-I и М-II во всех изучаемых группах штаммов (LD от 0,38 до 0,83; см. табл. 1), но не выявлено между маркером М-III и маркерами М-I и М-II и их сочетанием М-I/М-II во всех рассматриваемых группах (данные не приведены). Таким образом, рассматриваемые маркеры можно использовать для оценки разнообразия хромосомных типов, а кроме того, их можно учитывать как единый метаболический маркер (М-I/М-II), тогда как филогенетический маркер М-III следует рассматривать независимо.

 

Таблица 1

Неравновесие по сцеплению (LD) между маркерами M-I и M-II

LD

М-II

СКГ-К

СКГ-П

ПАГ-К

ПАГ-П

АЦ-П

M-I

СКГ-К

0,674

    

СКГ-П

 

0,639

   

ПАГ-К

  

0,376

  

ПАГ-П

   

0,830

 

АЦ-П

    

0,764

Примечание. К — штаммы, выделенные из клубеньков; П — штаммы, выделенные из почв; СКГ — Кавказский генцентр; ПАГ — Приаральский центр разнообразия люцерн.

 

Всего при анализе 218 штаммов обнаружено 35 из 510 теоретически возможных сочетаний маркеров М-III и M-I/М-II (Приложение, табл. 2). Восемь сочетаний встречались у штаммов из обеих географически изолированных популяций (СКГ и ПАГ), из них четыре — в группе штаммов из АЦ (данные не представлены), а пятнадцать — являлись уникальными, идентифицированными только у солеустойчивых К-изолятов из ПАГ (Приложение, см. табл. 2).

Разнообразие подгрупп штаммов оценивали согласно значениям индекса разнообразия Шеннона, рассчитанного по числу определенных сочетаний. Установлено, что К-изоляты из ПАГ были значительно разнообразнее, чем аналогичные группы штаммов из СКГ, тогда как для подгрупп П-изолятов из СКГ, ПАГ и АЦ такие различия отсутствовали (Приложение, см. табл. 2).

Проведена группировка 35 сочетаний маркерных последовательностей с учетом наличия референс- (A) и дивергентных (B) последовательностей филогенетического маркера М-III, а также референс- (I) и дивергентных аллелей (II) метаболического маркера. В результате были сформированы четыре контрастно различающиеся группы, которые рассматривали далее как хромосомные типы АI, АII, BI и BII. Тип АI (референс-тип) представлен одним сочетанием последовательностей «а» типа (HAI = 0), тогда как типы АII, BI и BII включали 8, 11 и 15 разных сочетаний соответственно (HAII = 1,48; HBI = 1,37; HBII = 2,58). Следует указать, что в типе АII с наибольшими частотами были представлены 2 из 8 сочетаний (частоты — 0,29 и 0,44), в типе BI — 1 из 11 (частота — 0,67), а в типе BII — 13 из 15 сочетаний (идентифицированы у единичных штаммов; суммарная частота — 0,87; данные не представлены).

Тип АI наблюдали преимущественно у солеустойчивых К- и П-изолятов из СКГ, при этом у последних в 1,2 раза чаще (средняя частота — 0,43; рис. 3). В выборке ПАГ этот же хромосомный тип был выявлен со сходной частотой только у солечувствительных П-изолятов (0,35) и не обнаружен у штаммов солеустойчивого фенотипа (см. рис. 3). В подгруппе П-изолятов из АЦ тип АI идентифицировали у единичных штаммов R-фенотипа (0,24; см. рис. 3). В остальных подгруппах (солечувствительные К- и П-изоляты из СКГ и К-изоляты из ПАГ) тип АI был выявлен со сходно низкими частотами (среднее значение — 0,10). Таким образом, хромосомный тип АI достоверно чаще идентифицировали у П-изолятов из СКГ (χ2 = 6,9; p = 8,5 ∙ 10–3; df = 1), имевших преимущественно солеустойчивый фенотип. Сравнение групп штаммов показало, что хромосомный тип АI встречался в 2,5 и 1,7 раза чаще у К-, чем у П-изолятов, из СКГ и ПАГ соответственно.

Тип АII (типовая последовательность М-III и дивергентные аллели М-I/М-II) выявлен у штаммов из всех рассматриваемых подгрупп. В трех подгруппах К- и П-изолятов разного фенотипа из ПАГ (средняя частота — 0,21), а также у солеустойчивых К-изолятов из СКГ (частота — 0,26) данный хромосомный тип встречался с близкими частотами (см. рис. 3). В остальных случаях хромосомный тип АII выявляли либо вдвое реже (подгруппы К- и П-изолятов разного фенотипа из СКГ), либо у единичных солечувствительных П-изолятов обоих генцентров (см. рис. 3). По результатам сравнения групп К- и П-изолятов из СКГ и ПАГ установлено, что хромосомный тип АII почти в 2 раза чаще встречался у К-изолятов, чем у соответствующих групп П-изолятов, как в том, так и в другом генцентре, однако достоверные различия получены только для К-изолятов из ПАГ (χ2 = 7,4; p = 6,6 ∙ 10–3, df = 1). Хромосомный тип АII доминировал только у солеустойчивых П-изолятов из АЦ (частота — 0,65; см. рис. 3).

 

Рис. 3. Встречаемость разных хромосомных типов у штаммов S. Meliloti. AI, AII, BI, BII — хромосомные типы (см. текст); остальные обозначения — см. рис. 2

 

Рис. 4. Встречаемость геномных островов в разных хромосомных типах S. meliloti: а — частота встречаемости одного, двух или трех островов в соответствующих хромосомных типах; б — частота встречаемости каждого из островов: Sme19T, Sme21T, Sme80S в соответствующих хромосомных типах; AI, AII, BI, BII — хромосомные типы (см. рис. 3)

 

Тип BI (дивергентные последовательности М-III и типовые аллели М-I/М-II) встречался существенно реже в изучаемых подгруппах штаммов, чем вышерассмотренный тип AII. Указанный тип преимущественно обнаружен в трех подгруппах (со сходными частотами): П-изоляты солеустойчивого фенотипа из СКГ и солечувствительного из ПАГ, а также у солеустойчивых К-изолятов ПАГ (средняя частота — 0,18; см. рис. 3). Реже этот же хромосомный тип был идентифицирован у солечувствительных К-изолятов из ПАГ (0,09; см. рис. 3). В остальных подгруппах указанный тип встречался у единичных штаммов (средняя частота — 0,03) либо не был выявлен (см. рис. 3). Сравнение групп штаммов показало, что тип BI достоверно чаще отмечен у К-изолятов из ПАГ и П-изолятов из СКГ, имевших солеустойчивый фенотип (χ2 = 8,1; p = 4,3 ∙ 10–3; df = 1).

Тип BII (дивергентные последовательности М-III и аллели М-I/М-II) идентифицирован у немногочисленных штаммов 8 из 10 изучаемых подгрупп (см. рис. 3). Чаще со сходными частотами указанный хромосомный тип встречался в трех подгруппах солеустойчивых К- и П-изолятов из ПАГ и К-изолятов из СКГ (средняя частота — 0,1; p > 0,5). Анализ групп штаммов показал, что тип BII наблюдали преимущественно у К-изолятов из ПАГ (p > 0,5).

Сравнительный анализ выборок штаммов из двух генцентров позволил установить, что хромосомный тип АI встречался более чем у 54 % штаммов S. meliloti из СКГ, то есть в 2,4 раза чаще, чем из ПАГ (χ2 = 18,6; p = 1,6 ∙ 10–5; df = 1). Преимущественно он был выявлен в подгруппе солеустойчивых П-изолятов из СКГ, в которой также отмечались штаммы, имевшие хромосомный тип BI, характеризовавшийся измененной последовательностью маркера М-III. В популяции штаммов S. meliloti из ПАГ, наоборот, более 76 % штаммов имели хромосомные типы, отличные от типа АI. Так, хромосомный тип АII выявлен в 1,4, тип BI — в 1,7, а тип BII — в 3,8 раза чаще у штаммов из ПАГ, чем из СКГ. Подавляющее большинство К-изолятов (65 %) из ПАГ имели хромосомный тип АII или BI, а 15 % штаммов солеустойчивого фенотипа — хромосомный тип BII. Описанные различия по встречаемости хромосомных типов между географически изолированными популяциями ПАГ и СКГ достоверны (χ2 = 20,6; p = 1,2 ∙ 10–4; df = 3). Штаммы из АЦ имели преимущественно хромосомный тип АII, характеризовавшийся измененными метаболическими маркерами.

Встречаемость ГО оценивали в группах штаммов S. meliloti с определенным хромосомным типом (АI, АII, BI или BII; рис. 4). Анализировали наличие трех ГО (как у референс-штамма Rm1021, см. «Материалы и методы»), а также возможное наличие двух или одного из трех ГО, сайты интеграции которых сходны с таковыми у Rm1021. Три ГО встречались крайне редко у штаммов, имевших хромосомный тип АI (частота — 0,04), но с более высокими частотами выявлены в случае хромосомных типов AII и BI (средняя частота — 0,11; см. рис. 4, а), а в случае типа BII — рассматриваемый вариант не обнаружен. Два ГО выявляли чаще (в среднем в 1,5 раза) у штаммов с хромосомным типом АI (средняя частота — 0,29; см. рис. 4, а). Один ГО встречался у подавляющего большинства штаммов (средняя частота — 0,72), но чаще, в 1,2 раза, у штаммов, имевших хромосомный тип BII (частота — 0,82; см. рис. ٤, а).

Рассматривали встречаемость каждого из ГО Rm1021 (Sme19T, Sme21T и Sme80S) у штаммов, имевших определенные хромосомные типы (см. рис. 4, б). Показано, что Sme19T и Sme80S достоверно чаще встречались у штаммов с хромосомными типами АI и АII соответственно (χ2 = 7,4; p = 2,4 ∙ 10–3; df = 2; см. рис. 4, б), а Sme80S — преимущественно у штаммов с типом BII (χ2 = 7,6; p = 5,9 ∙ 10–3; df = 2). Интересно, что любой из трех указанных островов встречался у штаммов с хромосомным типом BI с равными частотами (0,23; см. рис. 4, б).

Таким образом, выявлены достоверные различия по встречаемости ГО, относящихся к акцессорным элементам корового генома, у природных штаммов S. meliloti с разными хромосомными типами. Полученные результаты согласуются с данными для других видов клубеньковых бактерий и энтеробактерий [9, 26] и свидетельствуют в пользу того, что определенные акцессорные элементы могут быть ассоциированы с определенными сочетаниями коровых последовательностей.

ЗАКЛЮЧЕНИЕ

Сопряженный анализ маркерных последовательностей корового генома M-I и М-II, содержащих гены, продукты которых задействованы в клеточном метаболизме и вовлечены в процессы формирования стрессоустойчивости, а также последовательностей маркера М-III, используемых в филогенетических исследованиях на уровне вида, позволил оценить влияние экологических и эволюционных факторов на генетическое разнообразие природных штаммов клубеньковых бактерий S. meliloti в географически изолированных популяциях и в агроценозах. Выявлен высокий уровень полиморфизма метаболических (M-I, М-II) и филогенетического (М-III) маркеров в типических группах/подгруппах штаммов, различавшихся по району и источнику выделения, а также по фенотипу. По результатам анализа частот встречаемости разных аллелей маркеров M-I и М-II удалось заключить, что генотипическое разнообразие штаммов, выделенных из почв (П-изоляты), находится под давлением дизруптивного частотозависимого отбора, приводящего к преобладанию определенного генотипа, наиболее приспособленного к агроэкологическим условиям соответствующих генцентров. Высокое генотипическое разнообразие штаммов, выделенных из клубеньков растений (К-изоляты), произраставших в тех же генцентрах, обусловлено действием стабилизирующего частотозависимого отбора, что согласуется с работами других авторов [49, 50].

Оценка неравновесия по сцеплению (LD) маркерных последовательностей показала, что между метаболическими маркерами отсутствует или имеется низкий уровень генетической рекомбинации, на основании чего и согласно работе [10] они были использованы для определения сочетаний маркеров у 218 природных штаммов S. meliloti, сгруппированных далее в четыре хромосомных типа, различавшихся по наличию референс- и дивергентных последовательностей. Обнаружено, что географически изолированные популяции S. meliloti достоверно различались по встречаемости хромосомных типов, что согласуется с данными, полученными для других видов ризобий [9, 11, 53]. В популяции каждого из рассмотренных генцентров (СКГ и ПАГ) выявлены штаммы с измененными метаболическими маркерами (хромосомный тип АII), доля которых среди К-изолятов была почти в 2 раза выше, чем среди П-изолятов, в обоих генцентрах. Следует отметить, что штаммы с этим же хромосомным типом были выделены преимущественно из почв АЦ. Штаммы, имевшие измененные метаболические маркеры корового генома, могут относиться к дивергентным клональным линиям(ии), что согласуется с полученными ранее данными о наличии дивергентного хромосомного типа в популяции штаммов из ПАГ [39, 40, 51], тогда как для популяции из СКГ и штаммов из АЦ данные о наличии клональных линий получены впервые.

В центре интрагрессивной гибридизации люцерны в Приаралье (ПАГ), подверженном экстремальному засолению, около 40 % как К-, так и П-изолятов имели измененные филогенетический и в подавляющем большинстве метаболические маркеры (хромосомные типы B-I и B-II). Такие штаммы могут являться представителями нового биовара, что согласуется с ранее опубликованными данными [39]. Кроме того, штаммы, относящиеся к этому же или родственному биовару, впервые выявлены в СКГ, при этом они встречались исключительно среди П-изолятов и вдвое реже, чем у аналогичных изолятов из ПАГ. Клональные линии штаммов, обнаруженные в обеих географически изолированных популяциях клубеньковых бактерий, а также в агроценозах, и штаммы, относящиеся, возможно, к формирующемуся новому биовару клубеньковых бактерий люцерны, представляют объект дальнейших молекулярно-генетических исследований.

С целью выявления зависимости встречаемости акцессорных элементов от характеристик корового генома были проанализированы ГО в геномах штаммов S. meliloti, различавшихся по сочетаниям последовательностей маркеров корового генома. Это позволило впервые установить предпочтительность встречаемости того или иного геномного острова в определенных хромосомных типах S. meliloti. Полученные данные свидетельствуют в пользу гипотезы, высказанной авторами [26], о том, что разные хромосомные типы могут содержать разные акцессорные элементы.

Дополнительная информация

Работа выполнена с использованием оборудования ЦКП «Геномные технологии, протеомика и клеточная биология» ФГБНУ ВНИИСХМ при финансовой поддержке грантов РФФИ № 18-04-01278а (оценка структурного полиморфизма маркера М-II) и РНФ № 17-16-01095.

ПРИЛОЖЕНИЕ

Таблица 1

Значения критерия χ2 для подгрупп штаммов S. meliloti, различающихся по частотам встречаемости ПДРФ-типов маркерных последовательностей

 

Маркер

Группы штаммов

Значения критерия χ2

СКГ

ПАГ

АЦ

К

П

К

П

П

R

S

R

S

R

S

R

S

R

M-I

СКГ

К

R

 

I

10,0 (1)II

26,2 (2)

8,0 (2)

3,9 (1)

S

 

6,0 (1)

12,8 (2)

П

R

10,0 (1)

6,0 (1)

 

12,6 (3)

15,5 (2)

50,7 (2)

30,4 (1)

S

 

17,2 (3)

10,9 (2)

ПАГ

К

R

12,6 (3)

 

35,6 (3)

8,2 (3)

S

15,5 (2)

 

28,0 (3)

10,6 (3)

П

R

26,2 (2)

12,8 (2)

50,7 (2)

17,2 (3)

35,6 (3)

28,0 (3)

 

15,0 (2)

33,5 (2)

S

8,0 (2)

10,6 (3)

15,0

 

19,1 (2)

АЦ

П

R

3,9 (1)

30,4 (1)

10,9 (2)

8,2 (3)

33,5

19,1 (2)

 

М-II

СКГ

К

R

 

8,8 (3)

26,1 (3)

14,9 (3)

S

 

8,9 (2)

12,8 (2)

9,3 (2)

П

R

8,8 (3)

8,9 (2)

 

8,0 (2)

28,9 (2)

23,8 (2)

S

 

17,2 (2)

9,1 (2)

ПАГ

К

R

 

13,1 (3)

8,6 (3)

S

8,0 (2)

 

14,1 (2)

7,8 (2)

К

R

26,1 (3)

12,8 (2)

28,9 (2)

17,2 (2)

13,1 (3)

14,1 (2)

 

15,0 (1)

S

9,3 (2)

7,8 (2)

15,0 (1)

 

16,8 (2)

АЦ

П

R

14,9 (3)

23,8 (2)

9,1 (2)

8,6 (3)

16,8 (2)

 

М-III

СКГ

К

R

 

S

 

П

R

 

8,4 (2)

13,2 (2)

7,0 (2)

S

 

6,1 (2)

ПАГ

К

R

8,4 (2)

 

13,9 (2)

S

13,2 (2)

6,1 (2)

 

8,1 (2)

10,2 (2)

П

R

 

8,6 (2)

S

8,1 (2)

 

12,2 (2)

АЦ

П

R

7,0 (2)

13,9 (2)

10,2 (2)

8,6 (2)

12,2 (2)

 

Примечание. R — штаммы солеустойчивого фенотипа; S — штаммы солечувствительного фенотипа; К — штаммы, выделенные из клубеньков; П — штаммы, выделенные из почв; СКГ — Кавказский генцентр; ПАГ — Приаральский центр разнообразия люцерн; АЦ — агроценозы. I значение χ2 — меньше критического (различия не достоверны); (..)II число степеней свободы (df).

 

Таблица 2

Число выявленных сочетаний маркерных последовательностей M-I, M-II и M-III в исследуемых подгруппах и группах штаммов S. meliloti

Район

СКГ

ПАГ

АЦ

Всего штаммов

Группа

К

П

К

П

П

Подгруппа

R

S

R

S

R

S

R

S

R

S

Статистические характеристики

подгрупп

Всего сочетаний

6

3

9

4

20

11

4

5

4

2

35

Уникальные сочетания

4

1

6

1

15

6

2

3

3

2

 

Индекс Нея (N)

0,76

0,86

0,68

0,84

0,95

0,94

0,75

0,79

0,90

 

Индекс Шеннона (H)

1,28

0,96

1,34

1,16

2,67

2,13

1,07

1,23

1,18

 

Индекс выравненности (Е)

0,60

0,87

0,43

0,80

0,72

0,77

0,73

0,68

0,82

 

Всего штаммов

24

7

51

13

41

25

8

15

31

3

218

групп

Всего сочетаний

7

10

26

7

5

35

Уникальные сочетания

3

6

23

4

0

 

Индекс Нея (N)

0,76

0,69

0,94

0,88

0,87

 

Индекс Шеннона (H)

1,34

1,37

2,74

1,60

1,29

 

Индекс выравненности (Е)

0,54

0,39

0,59

0,70

0,72

 

Число штаммов

31

64

66

23

34

218

Примечание. R — штаммы солеустойчивого фенотипа; S — штаммы солечувствительного фенотипа; К — штаммы, выделенные из клубеньков; П — штаммы, выделенные из почв; СКГ — Кавказский генцентр; ПАГ — Приаральский центр разнообразия люцерн; АЦ — агроценозы.

 

Mariia E. Cherkasova

Federal State Budget Scientific Institution All-Russian Research Institute for Agricultural Microbiology

Email: mariiacherkasova@mail.ru
ORCID iD: 0000-0003-1873-9674
SPIN-code: 5341-5736
Scopus Author ID: 57191569585
ResearcherId: C-9626-2017

Russian Federation,  196608, Saint-Petersburg, Pushkin-8, sh. Podbelskogo 3

Research Engineer, Laboratory of Genetics and Breeding of Microorganisms

Victoria S. Muntyan

Federal State Budget Scientific Institution All-Russian Research Institute for Agricultural Microbiology

Email: vucovar@yandex.ru
ORCID iD: 0000-0002-1979-0853
SPIN-code: 7138-6763
Scopus Author ID: 56149831800
ResearcherId: K-5378-2013

Russian Federation, 196608, Saint-Petersburg, Pushkin-8, sh. Podbelskogo 3

Junior Researcher, Laboratory of Genetics and Breeding of Microorganisms

Alla S. Saksaganskaia

Federal State Budget Scientific Institution All-Russian Research Institute for Agricultural Microbiology

Email: allasaksaganskaya@mail.ru
ORCID iD: 0000-0002-8547-4904
SPIN-code: 5832-1676
Scopus Author ID: 57196477431
ResearcherId: H-8830-2017

Russian Federation, 196608, Saint-Petersburg, Pushkin-8, sh. Podbelskogo 3

Research Engineer, Laboratory of Genetics and Breeding of Microorganisms

Boris V. Simarov

Federal State Budget Scientific Institution All-Russian Research Institute for Agricultural Microbiology

Email: genet@yandex.ru
ORCID iD: 0000-0002-6893-557X
SPIN-code: 6859-1141
Scopus Author ID: 7003687173
ResearcherId: H-8898-2017

Russian Federation, 196608, Saint-Petersburg, Pushkin-8, sh. Podbelskogo 3

Doctor of Biology, Professor, Principal Researcher, Laboratory of Genetics and Breeding of Microorganisms

Marina L. Roumiantseva

Federal State Budget Scientific Institution All-Russian Research Institute for Agricultural Microbiology

Author for correspondence.
Email: mroumiantseva@yandex.ru
ORCID iD: 0000-0001-5582-6473
SPIN-code: 5470-9527
Scopus Author ID: 6506571716
ResearcherId: G-3628-2016
196608, Saint-Petersburg, Pushkin-8, sh. Podbelskogo 3

PhD (Candidate of Biology), Leading Researcher, Head of the Laboratory, Laboratory of Genetics and Breeding of Microorganisms

  1. Young JP, Crossman LC, Johnston AW, et al. The genome of Rhizobium leguminosarum has recognizable core and accessory components. Genome Biol. 2006;7(4):R34. https://doi.org/10. 1186/gb-2006-7-4-r34.
  2. Шестаков С.В. Как происходит и чем лимитируется горизонтальный перенос генов у бактерий // Экологическая генетика. – 2007. – Т. 5. – № 2. – С. 12–24. [Shestakov SV. How does the horizontal gene transfer in bacteria occur and than is it tied up. Ecological genetics. 2007;5(2):12-24. (In Russ.)]. https://doi.org/10. 17816/ecogen5212-24.
  3. Равин Н.В., Шестаков С.В. Геном прокариот // Вавиловский журнал генетики и селекции. – 2013. – Т. 17. – № 4–2. – С. 972–984. [Ravin NV, Shestakov SV. The genome of prokaryotes. Vavilov journal of genetics and breeding. 2013;17(4-2):972-984. (In Russ.)]
  4. Mauchline TH, Hayat R, Roberts R, et al. Assessment of core and accessory genetic variation in Rhizobium leguminosarum symbiovar trifolii strains from diverse locations and host plants using PCR-based methods. Lett Appl Microbiol. 2014;59(2):238-246. https://doi.org/10. 1111/lam.12270.
  5. Тихонович И.А., Андронов Е.Е., Борисов А.Ю., и др. Принцип дополнительности геномов в расширении адаптационного потенциала растений // Генетика. – 2015. – Т. 51. – № 9. – С. 973–990. [Tikhonovich IA, Andronov EE, Borisov AY, et al. The principle of genome complementarity in the enhancement of plant adaptive capacities. Russian Journal of Genetics. 2015;51(9):831-846. (In Russ.)]. https://doi.org/10. 7868/S001667581509012X.
  6. Chidebe IN, Jaiswal SK, Dakora FD. Distribution and phylogeny of microsymbionts associated with cowpea (Vigna unguiculata) nodulation in three agroecological regions of Mozambique. Appl Environ Microbiol. 2018;84(2). pii:e01712-17. https://doi.org/10. 1128/AEM.01712-17.
  7. Jiao J, Ni M, Zhang B, et al. Coordinated regulation of core and accessory genes in the multipartite genome of Sinorhizobium fredii. PLoS Genet. 2018;14(5):e1007428. https://doi.org/10. 1371/journal.pgen.1007428.
  8. Boussau B, Karlberg EO, Frank AC, et al. Computational inference of scenarios for alpha-proteobacterial genome evolution. Proc Natl Acad Sci USA. 2004;101(26):9722-9727. https://doi.org/10. 1073/pnas.0400975101.
  9. Wang X, Liu D, Luo Y, et al. Comparative analysis of Rhizobial chromosomes and plasmids to estimate their evolutionary relationships. Plasmid. 2018;96-97:13-24. https://doi.org/10. 1016/j.plasmid.2018. 03. 001.
  10. Young JP, Wexler M. Sym plasmid and chromosomal genotypes are correlated in field populations of Rhizobium leguminosarum. J Gen Microbiol. 1988;134:2731-9. https://doi.org/10. 1099/00221287-134-10-2731.
  11. Stefan A, van Cauwenberghe J, Rosu CM, et al. Genetic diversity and structure of Rhizobium leguminosarum populations associated with clover plants are influenced by local environmental variables. Syst Appl Microbiol. 2018;41(3):251-259. https://doi.org/10. 1016/j.syapm.2018. 01. 007.
  12. Van Berkum P, Badri Y, Elia P, et al. Chromosomal and symbiotic relationships of rhizobia nodulating Medicago truncatula and M. laciniata. Appl Environ Microbiol. 2007;73(23):7597-7604. https://doi.org/10. 1128/AEM.01046-07.
  13. Проворов Н.А., Андронов Е.Е., Онищук О.П., и др. Генетическая структура интродуцированных и местных популяций Rhizobium leguminosarum в системах «растения–почва» // Микробиология. – 2012. – Т. 81. – № 2. – С. 244–253. [Provorov NA, Andronov EE, Onishchuk OP, et al. Genetic structure of the introduced and local populations of Rhizobioum leguminosarum in plant-soil systems. Microbiology. 2012;81(2):224-232. (In Russ.)]
  14. Laguerre G, Mavingui P, Allard M-R, et al. Typing of rhizobia by PCR DNA fingerprinting and PCR-restriction fragment length polymorphism analysis of chromosomal and symbiotic gene regions: application to Rhizobium leguminosarum and its different biovars. Appl Environ Microbiol. 1996;62(6):2029-2036.
  15. Guo XW, Zhang XX, Zhang ZM, Li FD. Characterization of Astragalus sinicus rhizobia by restriction fragment length polymorphism analysis of chromosomal and nodulation genes regions. Curr Microbiol. 1999;39(6):358-364. https://doi.org/10. 1007/s002849900472.
  16. Efrose RC, Rosu CM, Stedel C, et al. Molecular diversity and phylogeny of indigenous Rhizobium leguminosarum strains associated with Trifolium repens plants in Romania. Antonie Van Leeuwenhoek. 2018;111(1):135-153. https://doi.org/10. 1007/s10482-017-0934-3.
  17. Galperin MY, Makarova KS, Wolf YI, Koonin EV. Expanded microbial genome coverage and improved protein family annotation in the COG database. Nucleic Acids Res. 2015;43:D261-269. https://doi.org/10. 1093/nar/gku1223.
  18. Zhang YM, Tian CF, Sui XH, et al. Robust markers reflecting phylogeny and taxonomy of Rhizobia. PLoS One. 2012;7(9):e44936. https://doi.org/10. 1371/journal.pone.0044936.
  19. Guo HJ, Wang ET, Zhang XX, et al. Replicon-dependent differentiation of symbiosis-related genes in Sinorhizobium strains nodulating Glycine max. Appl Environ Microbiol. 2014;80(4):1245-1255. https://doi.org/10. 1128/AEM.03037-13.
  20. Alexandre A, Laranjo M, Young JP, Oliveira S. dnaJ is a useful phylogenetic marker for alphaproteobacteria. Int J Syst Evol Microbiol. 2008;58(12):2839-2849. https://doi.org/10. 1099/ijs.0. 2008/001636-0.
  21. Biondi EG, Pilli E, Giuntini E, et al. Genetic relationship of Sinorhizobium meliloti and Sinorhizobium medicae strains isolated from Caucasian region. FEMS Microbiol Lett. 2003;220(2):207-213. https://doi.org/10. 1016/S0378-1097(03)00098-3.
  22. Escobar-Páramo P, Sabbagh A, Darlu P, et al. Decreasing the effects of horizontal gene transfer on bacterial phylogeny: the Escherichia coli case study. Mol Phylogenet Evol. 2004;30(1):243-250. https://doi.org/10. 1016/S1055-7903(03)00181-7.
  23. Matzke NJ. Model selection in historical biogeography reveals that founder-event speciation is a crucial process in island clades. Syst Biol. 2014;63(6):951-970. https://doi.org/10. 1093/sysbio/syu056.
  24. Dresler-Nurmi A, Fewer DP, Räsänen LA, Lindström K. The diversity and evolution of Rhizobia. In: Pawlowski K. (eds). Prokaryotic symbionts in plants. Springer-Verlag; 2009. P. 3-41.
  25. Tounsi-Hammami S, Le Roux C, Dhane-Fitouri S, et al. Genetic diversity of rhizobia associated with root nodules of white lupin (Lupinus albus L.) in Tunisian calcareous soils. Syst Appl Microbiol. 2019;42(4):448-456. https://doi.org/10. 1016/j.syapm.2019. 04. 002.
  26. Escobar-Páramo P, Clermont O, Blanc-Potard AB, et al. Specific genetic background is required for acquisition and expression of virulence factors in Escherichia coli. Mol Biol Evol. 2004;21(6):1085-1094. https://doi.org/10. 1093/molbev/msh118.
  27. Проворов Н.А. Симбиогенез как эволюция генетических систем открытого типа // Генетика. – 2018. – Т. 54. – № 8. – С. 879–889. [Provorov NA. Symbiogenesis as evolution of open genetic systems. Russian Journal of Genetics. 2018;54(8):888-896. (In Russ.)]. https://doi.org/10. 1134/S0016675818080106.
  28. Румянцева М.Л., Мунтян В.С., Черкасова М.Е., и др. Геномные острова штамма Sinorhizobium meliloti Rm1021 — азотфиксирующего симбионта люцерны // Генетика. – 2018. – Т. 54. – № 7. – С. 745-756. [Roumiantseva ML, Muntyan VS, Cherkasova ME, et al. Genomic islands in Sinorhizobium meliloti Rm1021, nitrogen-fixing symbiont of alfalfa. Russian Journal of Genetics. 2018;54(7):759-769. (In Russ.)]. https://doi.org/10. 1134/S0016675818070135.
  29. Barcellos FG, Menna P, da Silva Batista JS, Hungria M. Evidence of horizontal transfer of symbiotic genes from a Bradyrhizobium japonicum inoculant strain to indigenous diazotrophs Sinorhizobium (Ensifer) fredii and Bradyrhizobium elkanii in a Brazilian Savannah soil. Appl Environ Microbiol. 2007;73(8):2635-2643. https://doi.org/10. 1128/AEM.01823-06.
  30. Wielbo J. Rhizobial communities in symbiosis with legumes: genetic diversity, competition and interactions with host plants. Cent Eur J Biol. 2012;7(3):363-372. https://doi.org/10. 2478/s11535-012-0032-5.
  31. Румянцева М.Л., Мунтян В.С., Черкасова М.Е., и др. Сравнительный анализ геномных характеристик у референтных штаммов Sinorhizobium meliloti — симбионтов люцерны // Сельскохозяйственная биология. – 2017. – Т. 52. – № 5. – С. 928-939. [Roumiantseva ML, Muntyan VS, Cherkasova ME, et al. A comparative analysis of genomic characters of reference Sinorhizobium meliloti strains, the alfalfa symbionts. Agricultural Biology. 2017;52(5):928-939. (In Russ.)]. https://doi.org/10. 15389/agrobiology.2017. 5. 928rus.
  32. Che D, Hasan MS, Chen B. Identifying pathogenicity islands in bacterial pathogenomics using computational approaches. Pathogens. 2014;3(1):36-56. https://doi.org/10. 3390/pathogens3010036.
  33. Krogh TJ, Møller-Jensen J, Kaleta C. Impact of chromosomal architecture on the function and evolution of bacterial genomes. Front Microbiol. 2018;9:2019. https://doi.org/10. 3389/fmicb.2018. 02019.
  34. Dobrindt U, Hochhut B, Hentschel U, Hacker J. Genomic islands in pathogenic and environmental microorganisms. Nat Rev Microbiol. 2004;2(5):414-424. https://doi.org/10. 1038/nrmicro884.
  35. Juhas M, van der Meer JR, Gaillard M, et al. Genomic islands: tools of bacterial horizontal gene transfer and evolution. FEMS Microbiol Rev. 2009;33(2):376-393. https://doi.org/10. 1111/j.1574-6976. 2008. 00136. x.
  36. Мунтян В.С., Черкасова М.Е., Андронов Е.Е., и др. Встречаемость островов в геномах природных штаммов Sinorhizobium meliloti // Генетика. – 2016. – Т. 52. – № 10. – С. 1126–1133. [Muntyan VS, Cherkasova ME, Andronov EE, et al. Occurrence of islands in genomes of Sinorhizobium meliloti native isolates. Russian Journal of Genetics. 2016;52(10):1015-1022. (In Russ.)]. https://doi.org/10. 7868/S0016675816080105.
  37. Hudson CM, Lau BY, Williams KP. Islander: a database of precisely mapped genomic islands in tRNA and tmRNA genes. Nucleic Acids Res. 2015;43 (Database issue):D48-53. https://doi.org/10. 1093/nar/gku1072.
  38. Румянцева М.Л., Симаров Б.В., Онищук О.П., и др. Биологическое разнообразие клубеньковых бактерий в экосистемах и агроценозах. Теоретические основы и методы / Под ред. М.Л. Румянцевой, Б.В. Симарова. – СПб.; Пушкин: Инновационный центр защиты растений, 2011. – 104 с. [Roumiantseva ML, Simarov BV, Onishchuk OP, et al. Biologicheskoe raznoobrazie kluben’kovykh bakterii v ekosistemakkh i agrotsenozakh. Teoreticheskie osnovy i metody. Ed. by M.L. Rumyantseva, B.V. Simarov. Saint Petersburg; Pushkin: Innovatsionnyi tsentr zashchity rastenii; 2011. 104 p. (In Russ.)]
  39. Румянцева М.Л., Мунтян В.С., Менгони А., Симаров Б.В. ITS-полиморфизм солеустойчивых и солечувствительных природных штаммов Sinorhizobium meliloti — симбионтов люцерны, донника и пажитника // Генетика. – 2014. – Т. 50. – № 4. – С. 400–412. [Roumiantseva ML, Muntian VS, Mengoni A, Simarov BV. ITS-polymorphism of salt-tolerant and salt-sensitive native isolates of Sinorhizoblum meliloti – symbionts of alfalfa, clover and fenugreek plants. Russian Journal of Genetics. 2014;50(4):348-359. (In Russ.)]. https://doi.org/10. 7868/S0016675814040109.
  40. Румянцева М.Л., Мунтян В.С. Клубеньковые бактерии Sinorhizobium meliloti: солеустойчивость и ее генетическая детерминированность // Микробиология. – 2015. – Т. 84. – № 3. – С. 263–280. [Roumiantseva ML, Muntyan VS. Root nodule bacteria Sinorhizobium meliloti: tolerance to salinity and bacterial genetic determinants. Microbiology. 2015;84(3):303-318. (In Russ.)]. https://doi.org/10. 7868/S0026365615030179.
  41. Демидёнок О.И., Гончаренко А.В. Системы токсин-антитоксин бактерий и перспективы их использования в медицине (обзор) // Прикладная биохимия и микробиология. – 2013. – Т. 49. – № 6. – С. 539–546. [Demidenok OI, Goncharenko AV. Bacterial toxin-antitoxin systems and perspectives for their application in medicine. Applied Biochemistry and Microbiology. 2013;49(6):535-541. (In Russ.)]. https://doi.org/10. 7868/S055510991306007X.
  42. Rannala B, Qiu W-G, Dykhuizen DE. Methods for estimating gene frequencies and detecting selection in bacterial populations. Genetics. 2000;155(2):499-508.
  43. Rasmussen HB. Restriction fragment length polymorphism analysis of PCR-amplified fragments (PCR-RFLP) and gel electrophoresis – valuable tool for genotyping and genetic fingerprinting. Gel Electrophoresis – Principles and Basics. 2012. P. 315-334. https://doi.org/10. 5772/37724.
  44. Румянцева М.Л., Белова В.С., Онищук О.П., и др. Полиморфизм bet-генов у штаммов Sinorhizobium meliloti из генцентров люцерны // Сельскохозяйственная биология. – 2011. – Т. 46. – № 3. – С. 48–54. [Roumiantseva ML, Belova VS, Onishchouk OP, et al. Polymorphism of bet-genes among Sinorhizobium meliloti isolates native to gene centers of alfalfa. Agricultural Biology. 2011;46(3):48-54. (In Russ.)]
  45. Маниатис Т., Фрич Э., Сэмбрук Д. Методы генетической инженерии. Молекулярное клонирование / Пер. с англ. под ред. А.А. Баева, К.Г. Скрябина. – М.: Мир, 1984. – 479 с. [Maniatis T, Fritch EE, Sambrook J. Molecular cloning: a laboratory manual. Translated from English ed. by A.A. Baev, K.G. Skryabin. Moscow: Mir; 1984. 479 р. (In Russ.)]
  46. Hammer O, Harper DAT, Ryan PD. PAST: paleontological statistics software package for education and data analysis. Palaeontologia Electronica. 2001;4(1):1-9.
  47. Nei M. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics. 1978;89(3):583-590.
  48. Excoffier L, Lischer HE. Arlequin suite ver 3. 5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour. 2010;10(3):564-567. https://doi.org/10. 1111/j.1755-0998. 2010. 02847. x.
  49. Проворов Н.А., Андронов Е.Е., Онищук О.П. Формы естественного отбора, определяющего геномную эволюцию клубеньковых бактерий // Генетика. – 2017. – Т. 53. – № 4. – С. 401–410. [Provorov NA, Andronov EE, Onishchuk OP. Forms of natural selection controlling the genomic evolution in nodule bacteria. Russian Journal of Genetics. 2017;53(4):411-419. (In Russ.)]. https://doi.org/10. 7868/S0016675817040129.
  50. Levin BR. Frequency dependent selection in bacterial populations. Philos Trans R Soc Lond B Biol Sci. 1988;319(1196):459-472. https://doi.org/10. 1098/rstb.1988. 0059.
  51. Румянцева М.Л., Саксаганская А.С., Мунтян В.С., и др. Структурный полиморфизм генов вирулентности и солеустойчивости Sinorhizobium meliloti // Генетика. – 2018. – Т. 54. – № 5. – С. 524–534. [Roumiantseva ML, Saksaganskaia AS, Muntyan VS, et al. Structural polymorphism of Sinorhizobium meliloti genes related to virulence and salt tolerance. Russian Journal of Genetics. 2018;54(5):525-535. (In Russ.)]. https://doi.org/10. 7868/S001667581805003X.
  52. Румянцева М.Л., Онищук О.П., Белова В.С., и др. Полиморфизм штаммов Sinorhizobium meliloti, выделенных в центрах разнообразия люцерны, различающихся по почвенно-климатическим условиям // Экологическая генетика. – 2009. – Т. 7. – № 2. – С. 19–25. [Roumiantseva ML, Onischuk OP, Belova VS, et al. Polymorphism among Sinorhizobium meliloti isolates native to the origins of alfalfa diversity differed in soil-climate characteristics. Ecological genetics. 2009;7(2):19-25. (In Russ.)]. https://doi.org/10. 17816/ecogen7219-25.
  53. Palmer KM, Young JP. Higher diversity of Rhizobium leguminosarum biovar viciae populations in arable soils than in grass soils. Appl Environ Microbiol. 2000;66(6):2445-2450. https://doi.org/10. 1128/AEM.66. 6. 2445-2450. 2000.

Supplementary files

There are no supplementary files to display.

Views

Abstract - 41

PDF (Russian) - 20

Cited-By


PlumX


Copyright (c) 2019 Cherkasova M.E., Muntyan V.S., Saksaganskaia A.S., Simarov B.V., Roumiantseva M.L.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies