Diversity of PsSym29 and PsNRLK1 genes in the VIR germplasm collection of pea (Pisum sativum L.)
- Authors: Zhukov V.A.1,2,3, Zhernakov A.I.1,2, Belozerova M.Y.2, Dodueva I.E.2, Lebedeva M.A.2, Lutova L.A.2, Tikhonovich I.A.1,2
-
Affiliations:
- All-Russia Research Institute for Agricultural Microbiology
- Saint Petersburg State University
- Sirius University of Science and Technology
- Issue: Vol 20, No 4 (2022)
- Pages: 271-278
- Section: Genetic basis of ecosystems evolution
- URL: https://journals.eco-vector.com/ecolgenet/article/view/111959
- DOI: https://doi.org/10.17816/ecogen111959
- ID: 111959
Cite item
Abstract
BACKGROUND: N.I. Vavilov Institute of Plant Genetic Resources (VIR) (Saint Petersburg, Russia) maintains a large collection of pea (Pisum sativum L.). Earlier, several growth and yield parameters were recorded for plants of 99 accessions grown under inoculation with nodule bacteria and arbuscular mycorrhizal fungi.
MATERIALS AND METHODS: Polymorphism of genes encoding symbiotic receptor kinase PsSym29 [participating in the autoregulation of nodulation (AON) system] and closely related receptor kinase PsNRLK1 (with yet unknown function in symbiosis) was assessed in 99 pea genotypes from the VIR collection. Nucleotide diversity, Tajima’s D, and Fay and Wu’s H statistics were calculated using DNAsp 5.0 software. The significance of associations of allelic state of the sequenced genes with the growth and yield parameters was tested by two-way ANOVA followed by FDR correction and by regression analysis.
RESULTS: Nucleotide diversity and the ratio of synonymous to non-synonymous substitutions was greater in PsNRLK1 as compared to PsSym29. The analysis of Fay and Wu’s H in sliding window revealed signatures of positive selection in one site of PsSym29 and in three sites of PsNRLK1 gene sequences located in 1st exons encoding LRR (leucine rich repeat) domains. No significant associations of allelic state of neither PsSym29 nor PsNRLK1 genes was found with plant growth and yield parameters.
CONCLUSIONS: The sequences of both PsSym29 and PsNRLK1 genes undergo positive selection, but the conditions in which specific allelic states of the genes become adaptive are to be elucidated in future.
Full Text
BACKGROUND
Garden pea (Pisum sativum L.) is an important crop plant and a useful model for studying symbiotic interactions between legume plants and nodule bacteria [1]. Over 70,000 specimens of pea are maintained in large genetic collections [2], and for several of them, agriculturally important traits have been characterized. The collection of cultivated peas of N.I. Vavilov Institute of Plant Genetic Resources (VIR) (St. Petersburg, Russia) contains more than 8000 accessions, most of which were characterized with respect to agriculturally valuable features [3]. Among them, for a subset of 99 genotypes, growth and yield parameters were recorded for plants grown in symbiotic conditions (namely, under inoculation with either nodule bacteria (Rhizobia, Rh) or nodule bacteria plus arbuscular mycorrhizal fungi (Rh+AM) [4, 5].
The number of symbiotic nodules, as well as the rate of arbuscular mycorrhizal colonization, is controlled in legumes via a long-distance signaling system, called autoregulation of nodulation (AON). The AON system involves CLE (CLAVATA3/ EMBRYO SURROUNDING REGION-RELATED) peptides that migrate from nodulated roots into shoots, where they are perceived by a receptor kinase homologous to CLAVATA1 of Arabidopsis thaliana (L.) Heynh. (encoded by the gene MtSUNN (Super Numeric Nodules, Medtr4g070970) in Medicago truncatula Gaertn. and PsSym29 in P. sativum) [6]. The genome of M. truncatula contains 10 genes related to MtSUNN, among which only a single gene is up-regulated by rhizobia [7]. This gene, named Nodulation related LRR kinase 1 (MtNRLK1, Medtr5g090100), is considered a component of the AON system due to its nodule-specific expression profile; however, its detailed role in symbiosis is unclear [7].
The polymorphism of the genes that participate in AON may influence the amount of fixed nitrogen by modulation of number of nodules formed, and consequently, may contribute to the yield. Thus, to address a possible link between pea yield parameters and the AON components, we studied in detail the polymorphism of the PsSym29 gene, as well as its homologue PsNRLK1 with nodule-specific expression, and analyzed the association between non-synonymous nucleotide variations and earlier obtained data on plant yield and growth parameters on the set of 99 pea cultivars from the VIR collection.
MATERIALS AND METHODS
The set of 99 pea cultivars from the Pea World Germplasm Collection of the N.I. Vavilov Institute of Plant Genetic Resources (VIR, St. Petersburg, Russia) was initially selected as representing the diversity of the species Pisum sativum L. [4, 5]. This set contains genotypes from more than 25 countries and territories, and includes accessions belonging to P. sativum subsp. sativum (85), asiaticum (8), abyssinicum (3) and transaucasicum (3) (for detailed information see Supplementary files to V.A. Zhukov et al. [5]). In previous studies, the yield and growth parameters (PW — plant shoot weight, PL — plant shoot length, PN — pod number, SN — seed number per plant, SW — seed weight per plant, TSW — thousand-seed weight, NtS — seed nitrogen content, PhS — seed phosphorus content) were determined for plants grown under inoculation with rhizobia or under complex inoculation with rhizobia and AM fungi [4, 5]. For the present work, the DNA was extracted from one week old seedlings of the 99 genotypes using CTAB method with modifications, as described in A.S. Sulima et al. [8], and was used for genotyping.
The fragments of PsSym29 and PsNRLK1 genes were amplified using specific primers, which were designed with help of Primer3Plus program [9] (Table S1), and were sequenced in Evrogen company (Moscow, Russia). The sequences of the pea genes, along with MtSUNN (AY769943 in NCBI database) or MtNRLK1 (Medtr5g090100, M. truncatula genome v4.0) served as the outgroups, were aligned in Mega 5.0 [10], and the polymorphism analysis was performed in DNAsp 5.0 [11]. Tajima’s D and Fay and Wu’s H criteria were calculated in sliding window (size 100 bp, step 25 bp) using DNAsp 5.0 [11]. The statistical significance of the departure from the neutral evolution model was determined by coalescent simulations in DNAsp 5.0 [11]. Codon based Z test of neutrality (Nei–Gojobori method [12]) was performed in Mega 5.0 [10].
Single nucleotide variants (SNVs) were obtained by comparison of the aligned sequences, and for non-synonymous substitutions the significance of associations with the trait values was tested by two-way ANOVA with interaction analysis followed by FDR correction. Further, the association between the non-synonymous substitutions and AM-caused increments of traits (calculated as the increase of the trait values in Rh+AM conditions as compared to Rh conditions) were performed by regression analysis using models described in V.A. Zhukov et al. [5]. Likelihood Ratio Test for variable significance testing and FDR correction were used. All statistical analyses were performed using R Statistical Software (version 3.5.3). The association analysis was performed if the minor allele occurred in at least five cultivars. The effect of amino acid substitutions corresponding to the detected SNVs on the protein function (deleterious or not) was predicted by SIFT algorithm using the web-based tool (https://sift.bii.a-star.edu.sg) [13].
RESULTS AND DISCUSSION
The genes PsSym29 (Psat7g183240) and PsNRLK1 (Psat2g019520) consist of two exons separated by an intron and encode proteins possessing 20 LRR (leucine rich repeat) domains, a transmembrane domain, and a protein kinase domain (Fig. 1). On the protein level, PsSym29 and PsNRLK1 share 57.6% similarity and 44.1% identity; PsSym29 shows 88.0% similarity and 83.6% identity to MtSUNN, and PsNRLK1 shows 91.1% similarity and 86.7% identity to MtNRLK1. According to the pea gene expression atlas [14], PsSym29 has maximal expression level in leafs and tendrils, whereas PsNRLK1 has maximal expression level in symbiotic nodules (Fig. S1).
We sequenced the coding parts of the genes PsSym29 and PsNRLK1 in the set of 99 pea cultivars (the list is presented in Supplementary materials of V.A. Zhukov et al. [5]) and calculated the nucleotide diversity (π) of the gene sequences (Table 1). The gene PsNRLK1 appeared to be more diverse within the tested set of cultivars than PsSym29. Interestingly, the nucleotide diversity calculated for synonymic changes (πs) is comparable for the two genes, whereas the nucleotide diversity calculated for non-synonymic changes (πa) is greater for PsNRLK1 (Table 1). Consequently, the πa / πs ratio is greater for PsNRLK1 than for PsSym29, too. This fact may reflect stronger purifying selection pressure upon the PsSym29 gene sequence, as compared with PsNRLK1. In M. truncatula, mutations in MtSUNN (orthologue of PsSym29) lead to supernodulation phenotype of the plants [15], whereas mutations in MtNRLK1 do not affect any aspect of nitrogen-fixing symbiosis or plant development [7], thus indicating the higher importance of MtSUNN as compared to MtNRLK1. However, codon-based Z-test showed no deviations from the model of neutral evolution for both genes (for PsNRLK1: Z = –1.819, p-value = 0.071; for PsSym29: Z = –0.909, p-value = 0.365).
Table 1. Nucleotide diversity of PsSym29and PsNRLK1
Gene | s | a | a / s | |
PsSym29 | 2,87 · 10–3 | 7,17 · 10–3 | 1,13 · 10–3 | 0,158 |
PsNRLK1 | 4,48 · 10–3 | 6,94 · 10–3 | 1,98 · 10–3 | 0,285 |
Note. — nucleotide diversity, s — nucleotide diversity calculated for synonymous substitutions, a — nucleotide diversity calculated for non-synonymous substitutions, a / s — ratio of non-synonymous to synonymous substitutions.
In order to examine the polymorphic sites distribution within the gene sequences, and in order to find possible sites with specific selection signatures, we calculated nucleotide diversity (π) along with Tajima’s D and Fay and Wu’s H criteria in a sliding window. As seen in Fig. 1, the value of π for PsNRLK1 sequence increases remarkably in intronic part of the gene, indicating that the intron of PsNRLK1 is quite polymorphic, which is not the case for the PsSym29 gene, for which the π is low in both coding and non-coding parts of the gene. However, the nucleotide diversity of PsSym29 and PsNRLK1 sequences was at least five times lower than the π calculated in our previous study of the same pea cultivars for 1st exons of symbiotic receptor kinase genes PsSym37, PsK1 and PsLykX [8]. The Tajima’s D calculated either for the whole sequences (0.023 for PsSym29 and –0,607 for PsNRLK1) or for sliding windows of 100 bp length does not indicate any departure from neutral evolution model. The analysis of Fay and Wu’s H, however, revealed signatures of positive selection in one site of PsSym29 and in three sites of PsNRLK1 gene sequences (Fig. 1). This finding indicates that the sequences of both PsSym29 and PsNRLK1 are evolving, and newly arisen alleles of the genes are substituting the older ones. The identified sites containing non-synonymous substitutions (Fig. 1) are located within the first exons of the genes, which encode LRR domains that bind ligands (CLE peptides and, probably, other related peptides). Further studies based, for instance, on mathematical modeling of ligand-receptor interactions are required to elucidate whether the detected amino acid substitutions in LRR domains affect the binding properties of the receptors.
Fig. 1. Nucleotide diversity, Tajima’s D, and Fay and Wu’s H statistics calculated for PsSym29 and PsNRLK1 gene sequences, and the domain structure of the proteins encoded by the genes. Amino acid substitutions in sites with detected signals of positive selection are indicated. SP — signal peptide, LRR — leucine rich repeats, TM — transmembrane domain, kinase — protein kinase domain
The number of polymorphic sites in the sequences of the studied genes, which result in non-synonymous substitutions, was 8 for PsSym29 and 20 for PsNRLK1. After exclusion the rare alleles from the analysis, the number of analyzed sites remained was six for PsSym29 and seven for PsNRLK1 genes (Table S2). According to prediction of the SIFT program [13], all amino acid changes, except for Sym29.43PH, were considered ‘tolerated’, i. e., not changing the function of the proteins. The amino acid substitution P43H in PsSym29 sequence is located upstream of the LRR domain, and the corresponding amino acid in this site of orthologous MtSUNN is deleted, so it is unlikely that this amino acid change can affect the function of the PsSym29 protein.
For all analyzed polymorphic sites, no statistically significant impact of allelic states on growth and yield parameters was obtained (Table S2), and no influence of the allelic variants on the AM-caused increments of the parameters was observed (Table S3). In our previous work, allelic state of the non-symbiotic gene Le showed strong association with plant yield, and among the symbiotic genes, only PsLykX gene encoding receptor kinase participating in legume-rhizobial symbiosis showed association with TSW (thousand seed weight) [5]. This implies that the effect of amino acid substitutions was minor in the conditions of the experiment where the yield parameters were determined.
CONCLUSION
The pea gene PsSym29 with known role in autoregulation of nodulation and mycorrhization was less polymorphic than its homologue PsNRLK1, for which the function in plant growth and development is unknown to date. However, allelic states of both genes did not show associations with yield and growth parameters of pea plants grown in symbiotic conditions (i.e., under inoculation with either nodule bacteria or nodule bacteria and arbuscular mycorrhizal fungi). Remarkably, we found signatures of positive selection in 1st exons of the studied genes, which implies that some alleles of the genes can be advantageous in some conditions; however, if these conditions are symbiotic or non-symbiotic, remains to be analyzed in future.
ADDITIONAL INFORMATION
Author contribution. Thereby, all authors made a substantial contribution to the conception of the study, acquisition, analysis, interpretation of data for the work, drafting and revising the article, final approval of the version to be published and agree to be accountable for all aspects of the study. Contribution of each authors: V.A. Zhukov — research concept and design, analysis of gene polymorphism, writing text; A.I. Zhernakov — associative analysis, mathematical processing of the data obtained, writing text; M.Yu. Belozerova — amplification of fragments of studied genes, writing text, literature review; I.E. Dodueva — amplification of fragments of studied genes, writing text; M.A. Lebedeva — analysis of gene polymorphism, literature review, text writing; L.A. Lutova, I.A. Tikhonovich — research concept and design, discussion of results, text writing.
Competing interests. The authors declare that they have no competing interests.
Funding source. The work was supported by the grant of Saint Petersburg State University: ID 93020341.
Appendix
Fig. S1. The heatmap diagram illustrating expression levels (normalized RPKM values) of the PsNRLK1 and PsSYM29 genes in different pea organs according to transcriptomic data by S. Alves-Carvalho et al. [14]. The heatmap was generated using Morpheus software (https://software.broadinstitute.org/morpheus)
Table S1. Primers used for amplification and sequencing of the genes PsSym29 and PsNRLK1
Gene | Name of the primer | Sequence, 5'-3' | Length of the PCR product, bp |
PsNRLK1 | PsNRLK1-F1 | ATATTCCTATGTCTTCTTTCACCTTTCTTC | 704 |
PsNRLK1-R1 | TTCACCTTTCAAACCACAGTTAGCAAG | ||
PsNRLK1-F2 | GGTAATCTTGTTAGTTTGGTTCATCTTGA | 803 | |
PsNRLK1-R2 | CCTATATCTTGAGGAATTTCACCTGAGA | ||
PsNRLK1-F3 | CAGATTCTGCTTCTTCATGGAAATAGAT | 837 | |
PsNRLK1-R3 | AAGGCATAGATACATTGTGAAGTTGTTG | ||
PsNRLK1-F4 | TAACAAAGGTAGTTCTTATGATAATGGTT | 763 | |
PsNRLK1-R4 | GTAAAGCAACCAAATATCTTTCATGTGTAG | ||
PsSym29 | PsSYM29-F1 | CGTGTTATTTGCTGGTATTCTTCTGC | 987 |
PsSYM29-R1 | CGCCTATGAATGCCTGAACAGAA | ||
PsSYM29-F2 | GCAAATGAACAACCTCACCG | 1066 | |
PsSYM29-R2 | CGAGGGAAAGGTATAGGAAG | ||
PsSYM29-F3 | CGTTTTTCGGAAACCCTAACCTCTGT | 1084 | |
PsSYM29-R3 | GGTGGATTAGTGAGCACATGAACTACTTC |
Table S2. FDR-corrected p-values of F-tests for significance of the SNV (single nucleotide variation) factor’s effect on growth and yield parameters values in two-way ANOVA-tests
SNV | PW, Plant shoot weight, g | PL, Plant shoot length, cm | PN, Pod number | SN, Seed number per plant | SW, Seed weight per plant, g | TSW, Thousand seed weight, g | NtS, Seed nitrogen content, mg/g | PhS, Seed phosphorus content, mg/g |
NRLK1.19SL | 0.8975 | 0.8975 | 0.8975 | 0.8975 | 0.8975 | 0.9013 | 0.8975 | 0.8975 |
NRLK1.30SP | 0.5255 | 0.9871 | 0.8602 | 0.5255 | 0.5255 | 0.3465 | 0.9871 | 0.9871 |
NRLK1.212RG | 0.8226 | 0.8226 | 0.8226 | 0.1208 | 0.8226 | 0.2551 | 0.8226 | 0.8226 |
NRLK1.356LQ | 0.7879 | 0.0188 | 0.8651 | 0.7879 | 0.7879 | 0.7879 | 0.6018 | 0.6721 |
NRLK1.443GR | 0.6138 | 0.0670 | 0.7739 | 0.6138 | 0.6292 | 0.6138 | 0.6138 | 0.6138 |
NRLK1.875FY | 0.6113 | 0.6113 | 0.6113 | 0.6113 | 0.6765 | 0.6113 | 0.6113 | 0.9087 |
NRLK1.890GE | 0.2631 | 0.2728 | 0.2365 | 0.2631 | 0.2816 | 0.2599 | 0.2728 | 0.3020 |
Sym29.16FS | 0.2778 | 0.1792 | 0.8113 | 0.3173 | 0.4688 | 0.8113 | 0.8113 | 0.2778 |
Sym29.43PH | 0.4068 | 0.7399 | 0.8814 | 0.8814 | 0.5393 | 0.1745 | 0.7858 | 0.8814 |
Sym29.53AGV | 0.4022 | 0.7395 | 0.8792 | 0.8792 | 0.5575 | 0.2034 | 0.7608 | 0.8792 |
Sym29.171IF | 0.7670 | 0.6475 | 0.6475 | 0.8005 | 0.8005 | 0.6475 | 0.6475 | 0.6676 |
Sym29.S618P | 0.4857 | 0.3378 | 0.4857 | 0.3378 | 0.4857 | 0.4857 | 0.3378 | 0.4857 |
Sym29.T623I | 0.5105 | 0.4421 | 0.7061 | 0.6451 | 0.5105 | 0.8590 | 0.4021 | 0.5105 |
Table S3. FDR-corrected p-values of Likelihood-Ratio Tests for significance of the SNV (single nucleotide variation) factor’s effect on AM-caused increments of growth and yield parameters
SNV | PW, Plant shoot weight, g | PL, Plant shoot length, cm | PN, Pod number | SN, Seed number per plant | SW, Seed weight per plant, g | TSW, Thousand seed weight, g | NtS, Seed nitrogen con-tent, mg/g | PhS, Seed phosphorus content, mg/g |
NRLK1.19SL | 0.3444 | 0.7264 | 0.7264 | 0.7264 | 0.4034 | 0.3444 | 0.4034 | 0.3444 |
NRLK1.30SP | 0.4384 | 0.8388 | 0.8003 | 0.8388 | 0.6873 | 0.4384 | 0.6873 | 0.4384 |
NRLK1.212RG | 0.8517 | 0.8517 | 0.8517 | 0.8861 | 0.8517 | 0.3277 | 0.8517 | 0.8861 |
NRLK1.356LQ | 0.1350 | 0.8911 | 0.7722 | 0.8412 | 0.1350 | 0.1209 | 0.1350 | 0.5528 |
NRLK1.443GR | 0.2186 | 0.9221 | 0.9221 | 0.9221 | 0.2186 | 0.0901 | 0.1646 | 0.9221 |
NRLK1.875FY | 0.2499 | 0.2499 | 0.4094 | 0.4488 | 0.2499 | 0.4453 | 0.7828 | 0.4094 |
NRLK1.890GE | 0.3769 | 0.9540 | 0.8308 | 0.9591 | 0.4788 | 0.3769 | 0.4788 | 0.4788 |
Sym29.16FS | 0.8836 | 0.8998 | 0.8998 | 0.8836 | 0.8836 | 0.6663 | 0.8836 | 0.8836 |
Sym29.43PH | 0.1674 | 0.8405 | 0.7943 | 0.9994 | 0.3782 | 0.1674 | 0.7943 | 0.7943 |
Sym29.53AGV | 0.9035 | 0.7123 | 0.5304 | 0.5304 | 0.9035 | 0.5304 | 0.7123 | 0.7123 |
Sym29.171IF | 0.8495 | 0.8495 | 0.8495 | 0.8495 | 0.8495 | 0.8495 | 0.8495 | 0.8495 |
Sym29.S618P | 0.5022 | 0.9898 | 0.5022 | 0.9898 | 0.5853 | 0.5022 | 0.9898 | 0.5022 |
Sym29.T623I | 0.7992 | 0.7992 | 0.5987 | 0.8889 | 0.8042 | 0.7992 | 0.7992 | 0.5987 |
About the authors
Vladimir A. Zhukov
All-Russia Research Institute for Agricultural Microbiology; Saint Petersburg State University; Sirius University of Science and Technology
Author for correspondence.
Email: vzhukov@arriam.ru
ORCID iD: 0000-0002-2411-9191
SPIN-code: 2610-3670
Scopus Author ID: 35325957900
Cand. Sci. (Biol.), PhD, Leading Research Associate, Head of the Laboratory of Genetics of Plant-Microbe Interactions
Russian Federation, Saint Petersburg; Saint Petersburg; Saint PetersburgAleksandr I. Zhernakov
All-Russia Research Institute for Agricultural Microbiology; Saint Petersburg State University
Email: AZhernakov@arriam.ru
ORCID iD: 0000-0001-8961-9317
Scopus Author ID: 16403813100
Junior Research Associate, Laboratory of Genetics of Plant-Microbe Interactions
Russian Federation, Saint Petersburg; Saint PetersburgMaria Yu. Belozerova
Saint Petersburg State University
Email: m-kitty@mail.ru
Student
Russian Federation, Saint PetersburgIrina E. Dodueva
Saint Petersburg State University
Email: wildtype@yandex.ru
SPIN-code: 8061-2388
PhD, Cand. Sci. (Biol.), Associate Professor, Department of Genetics and Biotechnology
Russian Federation, Saint PetersburgMaria A. Lebedeva
Saint Petersburg State University
Email: mary_osipova@mail.ru
SPIN-code: 6000-6307
PhD, Cand. Sci. (Biol.), Senior Research Associate, Department of Genetics and Biotechnology
Russian Federation, Saint PetersburgLudmila A. Lutova
Saint Petersburg State University
Email: la.lutova@gmail.com
SPIN-code: 3685-7136
Dr. Sci. (Biol.), Professor, Department of Genetics and Biotechnology
Russian Federation, Saint PetersburgIgor A. Tikhonovich
All-Russia Research Institute for Agricultural Microbiology; Saint Petersburg State University
Email: igor.tikhonovich49@mail.ru
SPIN-code: 6685-9419
Dr. Sci. (Biol.), Professor RAS, Dean of Faculty of Biology
Russian Federation, Saint Petersburg; Saint PetersburgReferences
- Tsyganov VE, Tsyganova AV. Symbiotic Regulatory Genes Controlling Nodule Development in Pisum sativum L. Plants. 2020;9(12):1741. doi: 10.3390/plants9121741
- Smýkal P, Coyne C, Redden R, Maxted N. Genetic and Genomic Resources of Grain Legume Improvement: 3. Elsevier, 2013. 77 p.
- Sinjushin A, Semenova E, Vishnyakova M. Usage of morphological mutations for improvement of a garden pea (Pisum sativum): the experience of breeding in Russia. Agronomy. 2022;12(3):544. doi: 10.3390/agronomy12030544
- Yakobi LM, Kukalev AS, Ushakov KV, et al. Polimorfizm form gorokha posevnogo po ehffektivnosti simbioza s ehndomikoriznym gribom Glomus sp. v usloviyakh inokulyatsii rizobiyami. Agricultural Biology. 2000;35(3):94–102. (In Russ.)
- Zhukov VA, Zhernakov AI, Sulima AS, et al. Association study of symbiotic genes in pea (Pisum sativum L.) cultivars grown in symbiotic conditions. Agronomy. 2021;11(11):2368. doi: 10.3390/agronomy11112368
- Roy S, Liu W, Nandety RS, et al. Celebrating 20 years of genetic discoveries in legume nodulation and symbiotic nitrogen fixation. Plant Cell. 2020;32(1):15–41. doi: 10.1105/tpc.19.00279
- Laffont C, De Cuyper C, Fromentin J, et al. MtNRLK1, a CLAVATA1-like leucine-rich repeat receptor-like kinase upregulated during nodulation in Medicago truncatula. Sci Rep. 2018;8(1):2046. doi: 10.1038/s41598-018-20359-4
- Sulima AS, Zhukov VA, Afonin AA, et al. Selection signatures in the first exon of paralogous receptor kinase genes from the sym2 region of the Pisum sativum L. Genome. Front Plant Sci. 2017;8:1957. doi: 10.3389/fpls.2017.01957
- Untergasser A, Nijveen H, Rao X, et al. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 2007;35(S2): W71–W74. doi: 10.1093/nar/gkm306
- Tamura K, Peterson D, Peterson N, et al. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28(10):2731–2739. doi: 10.1093/molbev/msr121
- Librado P, Rozas J. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics. 2009;25(11): 1451–1452. doi: 10.1093/bioinformatics/btp187
- Nei M, Gojobori T. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol Biol Evol. 1986;3(5):418–426. doi: 10.1093/oxfordjournals.molbev.a040410
- Ng PC, Henikoff S. SIFT: Predicting amino acid changes that affect protein function. Nucleic Acids Res. 2003;31(13):3812–3814. doi: 10.1093/nar/gkg509
- Alves-Carvalho S, Aubert G, Carrère S, et al. Full-length de novo assembly of RNA-seq data in pea (Pisum sativum L.) provides a gene expression atlas and gives insights into root nodulation in this species. Plant J. 2015;84(1):1–19. doi: 10.1111/tpj.12967
- Schnabel E, Journet E-P, de Carvalho-Niebel F, et al. The Medicago truncatula SUNN gene encodes a CLV1-like leucine-rich repeat receptor kinase that regulates nodule number and root length. Plant Mol Biol. 2005;58(6):809–822. doi: 10.1007/s11103-005-8102-y