Influence of γ-irradiation on the expression of encoding ABA metabolism enzymes in barley embryos

Cover Page

Abstract


Background. Small doses of radiation stimulate the growth and development of plants including seed germination. ABA plays a key role not only in seed dormancy and germination but also in the regulation of adaptive reactions of plants.

The aim of our work was to study the effect of γ-irradiation of barley seeds in a small doses on the expression of genes encoding ABA biosynthesis enzyme 9-cis-epoxycarotenoid dioxygenase (HvNCED1) and catabolism enzyme ABA 8’-hydroxylase (HvABA8’OH-1).

Materials and Methods. The barley seeds were irradiated at dose range of 4–50 Gy at a dose rate of 60 Gy/h, the radiation source was 60Co. The study was carried out in the embryos within the first 30 hours after germination. Relative gene expression was investigated using real-time PCR (RT-PCR).

Results. It was shown that γ-irradiation of barley seeds changes the expression of ABA biosynthesis and catabolism genes in all experimental groups.

Conclusion. This alterations can lead to a decrease the ABA content under irradiation with stimulating doses and increase the biosynthesis of phytohormone under irradiation with inhibitory dose.


ВВЕДЕНИЕ

Абсцизовая кислота — один из пяти классических фитогормонов растений, играет ключевую роль во многих процессах жизнедеятельности растений, включая поддержание покоя семян и ингибирование их прорастания [1]. АБК нередко называют «гормоном стресса», благодаря ее исключительному значению для процессов адаптации к различным биотическим и абиотическим стрессам. В стрессовых условиях эндогенные уровни АБК резко увеличиваются, активируя сигнальные пути и изменяя экспрессию генов, вовлеченных в ответ на стресс [2].

Прорастание семени является критическим этапом в жизни растений, существенно зависящим от факторов окружающей среды. Неблагоприятные условия могут угнетать прорастание, снижать жизнеспособность проростков и негативно сказываться на морфологических показателях [3]. Однако низкие дозы стрессоров могут приводить к противоположному эффекту. В начале прошлого века было установлено, что ионизирующие излучения (ИИ) в малых дозах могут ускорять рост и развитие растений, стимулировать прорастание семян [4].

В нашей предыдущей работе [5] было исследовано влияние γ-облучения семян ячменя сорта Нур в дозах 4–50 Гр на содержание основных классов фитогормонов в проростках на ранних этапах онтогенеза. Показано, что облучение в стимулирующих развитие проростков дозах приводило преимущественно к уменьшению содержания АБК, применение ингибирующей рост дозы 50 Гр вызывало ее накопление.

Эндогенное содержание АБК определяется балансом ее биосинтеза и катаболизма [6]. Семейство генов NCED кодирует важнейший фермент биосинтеза диоксигеназу 9-цис-эпоксикаротиноидов. Катаболизм АБК в ячмене регулируется генами HvABA8’OH из семейства CYP707A, продуктом которого является фермент 8’-гидроксилаза АБК [6]. Экспрессия генов NCED и ABA8’OH выступает ключевым фактором, контролирующим уровень АБК и, соответственно, процесс покоя и прорастания [7].

Таким образом, для выяснения механизмов изменения содержания АБК в облученных проростках мы изучили влияние γ-облучения на экспрессию генов, кодирующих ферменты биосинтеза и катаболизма АБК в первые 30 часов прорастания.

МАТЕРИАЛЫ И МЕТОДЫ

Объектом исследования был выбран ячмень (Hor deum vulgare L.) сорта Нур первой репродукции. Воздушно-сухие семена (влажность — 13–15 %) облучали в дозах 4, 10, 16, 20, 50 Гр при мощности дозы 60 Гр/ч на установке ГУР-120 (ВНИИРАЭ, Обнинск) с источником излучения 60Со. Контролем служили необлученные семена. Сразу после облучения семена замачивали в дистиллированной воде рулонным методом согласно ГОСТу 12038–84 [8] и помещали в термостат MIR-254 (Sanyo, Япония) без освещения при температуре 20 °C на 6, 12, 18, 24 и 30 часов экспозиции в рулонах.

Для каждой биологической повторности из 20 семян извлекали зародыши и фиксировали в жидком азоте до экстракции. Все измерения проводили в трех биологических повторностях (т. е. 60 семян на одну экспериментальную точку). Зародыши гомогенизировали и выделяли РНК при помощи набора NucleoSpin TriPrep фирмы Macherey-Nagel согласно протоколу производителя. Синтез кДНК на матрице РНК проводили при помощи набора реактивов MMLV RT kit фирмы «Евроген». Концентрацию нуклеиновых кислот измеряли спектрофотометром NanoDrop и флуориметром Qubit 2.0 с использованием наборов реактивов для флуориметрического измерения концентрации ДНК и РНК фирмы Invitrogen согласно протоколу производителя.

У ячменя известны два гена, кодирующих фермент биосинтеза АБК диоксигеназу 9-цис-эпоксикаротиноидов (HvNCED1и HvNCED2), и два гена, кодирующих фермент катаболизма 8’-гидроксилазу АБК (HvABA8’OH-1 и HvABA8’OH-2). Генами интереса в рамках данной работы выступали гены HvNCED1 (синтез) и HvABA8’OH-1 (катаболизм), так как их экс прессия наиболее чувствительна к действию внешних факторов, в отличие от паралогов [9, 10]. В качестве референтного был выбран ген 18SrRNA, кодирующий 18S-субъединицу рРНК. У ячменя данный ген входит в число наиболее стабильных генов домашнего хозяйства в условиях биотических и абиотических стрессов и рекомендуется к использованию в качестве референт ного при исследовании транскрипционной активности [11]. В качестве праймеров применяли следующие последовательности:

  • к 18SrRN — GTGACGGGTGACGGAGAATT и GACACTAATGCGCCCGGTAT [11];
  • к HvNCED1 — CCAGCACTAATCGATTCC и GAGAGTGGTGATGAGTAA;
  • к HvABA8’OH-1 — AGCACGGACCGTCAAAGTC и TGAGAATGCCTACGTAGTG [9].

Уровень транскрипционной активности генов интереса определяли посредством ПЦР в режиме реального времени на амплификаторе ДТ-96 фирмы ДНК-Технология. Реакционные смеси готовили на основе набора реактивов HS TaqDNA Polymerase dNTP mix фирмы «Евроген». Для детекции накопления продуктов ПЦР в режиме реального времени использовали флюоресцирующий краситель SYBR Green I фирмы Lumiprobe.

Реакции осуществляли в объеме 20 мкл с первичной денатурацией в течение 10 мин при 95 °C, затем 50 цик лов с тремя температурными полками: 94 °C — 20 с, 60 °C — 20 с, 72 °C — 20 с. Определение накопления продуктов амплификации проводили автоматически, на стадии отжига праймеров (60 °C) каждого цикла.

Реакции выполняли в трех повторах (триплетах) для каждой матрицы кДНК. В случае если значения порогового цикла реакции (Сt) в триплете различались на 0,5 и более, результаты по данному триплету признавали недействительными, и реакцию для данной матрицы проводили повторно. Пороговую линию выставляли автоматически в среде специализированного программного обеспечения фирмы ДНК-Технология. Относительный уровень транскрипционной активности целевых генов рассчитывали методом 2-ΔΔCT [12].

Экспериментальные данные анализировали, используя непараметрическую статистику с помощью программ Microsoft Office Excel 2003 и STATISTICA 6.0. Статистическую значимость отличий оценивали с помощью U-критерия Манна – Уитни. Hа диаграммах представлены средние значения.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Обнаружено изменение транскрипционной активности исследуемых генов в облученной группе на всех этапах экспозиции в рулонах (6–30 ч), и даже в зародышах воздушно-сухих семян. Максимальные значения экспрессии гена биосинтеза АБК зафиксированы при дозе 50 Гр на 24 часа экспозиции и в воздушно-сухих зародышах (рис. 1), что указывает на активацию синтеза АБК. Именно при этой дозе в предыдущем экс перименте отмечалось накопление АБК в проростках ячменя [5].

 

Рис. 1. Транскрипционная активность гена HvNCED1, кодирующего фермент биосинтеза АБК, в зародышах в зависимости от дозы облучения семян и времени экспозиции в рулонах с дистиллированной водой. 0 — нет детекции; * различия статистически значимы по сравнению с контрольными значениями, p < 0,05, U-тест Манна – Уитни

Fig. 1. Transcriptional activity of the gene HvNCED1 encoding the ABA biosynthesis enzyme in embryos depending on the dose of seed irradiation and incubation time in rolls with distilled water. 0 – no detection; *differences are statistically significant compared to control values, p < 0.05, Mann-Whitney U-test

 

На 6-й, 12-й и 18-й час экспозиции при дозах, ведущих к снижению уровня АБК в ранее проведенном эксперименте (4–20 Гр), транскрипционная активность гена, кодирующего фермент биосинтеза АБК, была преимущественно подавлена, что может обусловливать низкие уровни фитогормона. На 24-й и 30-й час экспозиции транскрипционная активность гена HvNCED1 в контроле резко понизилась. На этом фоне в облученной группе фиксировали увеличение исследуемого параметра при всех используемых дозах, максимальное — при дозе облучения 50 Гр. В сухом семени, на 24-й и 30-й час наблюдали положительную корреляцию значений транскрипционной активности с дозой излучения (r = 0,88, p < 0,05; r = 0,88, p < 0,05; r = 0,91 p < 0,05 соответственно).

Увеличение транскрипционной активности гена, кодирующего фермент катаболизма АБК HvABA8’OH-1 может указывать на снижение содержания АБК в зародышах семян ячменя. В эксперименте транскрипционная активность гена HvABA8’OH-1 увеличивалась на каждом этапе экспозиции в зависимости от дозы, однако статистически значимо в сухом семени на 18-й и 30-й час экспозиции (рис. 2). На 18-й час экспозиции значимое увеличение исследуемого параметра фиксировали при дозах 16 и 20 Гр, причем при 20 Гр отмечали самое большое значение генной экспрессии в эксперименте. В ранее проведенных исследованиях на ячмене именно при этих дозах (16–20 Гр) наблюдали стимуляцию развития проростков [13], увеличение активности ферментов антиоксидантной системы [14], снижение содержания АБК и увеличение уровней гормонов, стимулирующих прорастание семян [5].

 

Рис. 2. Транскрипционная активность гена HvABA8’OH-1, кодирующего фермент катаболизма АБК, в зародышах в зависимости от дозы облучения семян и времени экспозиции в рулонах с дистиллированной водой. * различия статистически значимы по сравнению с контрольными значениями, p < 0,05, U-тест Манна – Уитни

Fig. 2. Transcriptional activity of the gene HvABA8’OH-1 encoding the ABA catabolism enzyme in embryos depending on the dose of seed irradiation and incubation time in rolls with distilled water. * differences are statistically significant compared to control values, p < 0.05, Mann-Whitney U-test

 

Снижение экспрессии гена катаболизма АБК при дозе 50 Гр, отмечавшееся на 12-й и 18-й час экспозиции могло вести к повышению содержания АБК. Действительно, облучение семян ячменя ингибирующей рост дозой 50 Гр приводило к накоплению АБК в проростках [5]. Следует отметить, что снижение транскрипционной активности HvABA8’OH-1 происходило и при использовании некоторых стимулирующих доз с 6-го по 18-й час экспозиции.

Предполагается, что прерывание покоя в ячмене происходит за счет изменения содержания гиббереллинов, а содержание АБК и экспрессия генов ее метаболизма не играет существенной роли [10]. Однако в нашей предыдущей работе показано, что содержание АБК в проростках ячменя снижается после облучения семян в стимулирующих рост дозах 4–20 Гр и увеличивается после применения ингибирующей рост дозы 50 Гр [5].

Молекулярные изменения в результате действия ИИ опосредованы индукцией активных форм кислорода (АФК) [15]. Рассматривая изменения в экспрессии генов метаболизма АБК, необходимо учитывать роль АФК как в процессе прорастания, так и при ответе на стресс. В условиях стресса в растениях индуцируются большие количества АФК, что ведет к увеличению содержания АБК за счет усиления синтеза и уменьшения катаболизма [16]. Однако повышенные концентрации АФК во время прорастания семян увеличивают экспрессию генов катаболизма АБК и, таким образом, снижают уровни АБК [17]. Итак, АФК могут как положительно, так и отрицательно регулировать содержание АБК в зависимости от их концентрации и локализации. Изменения в транскрипционной активности исследуемых генов после облучения семян дозой 50 Гр свидетельствуют в пользу проявления окислительного стресса и увеличения потенциала синтеза АБК.

Результаты настоящей работы демонстрируют, что гамма-облучение семян изменяет экспрессию генов, кодирующих ферменты биосинтеза и катаболизма АБК в зародышах ячменя. Изменения фиксировали на всех этапах экспозиции, даже в зародышах воздушно-сухих семян. Использование стимулирующих доз преимущественно приводило к снижению транскрипционной активности гена биосинтеза АБК HvNCED1 с 6-го по 18-й час экспозиции и различной динамике накопления транскриптов гена катаболизма АБК HvABA8’OH-1, в том числе резкому увеличению их содержания на 18-й час при дозе 20 Гр, что может вызвать снижение уровней АБК в исследуемой ткани. Применение ингибирующей дозы 50 Гр приводило к увеличению транскрипционной активности гена HvNCED1 и снижению активности гена HvABA8’OH-1 с 6-го по 18-й час экспозиции, что может вызвать накопление АБК. Полученные экспериментальные данные свидетельствуют о противонаправленном действии γ-облучения на экспрессию изучаемых генов. Это может указывать на распространенное явление, при котором гены одного семейства демонстрируют различную и даже противоположную динамику транскрипционной активности при одном и том же воздействии, что было показано на генах биосинтеза различных фитогормонов [9, 18]. Разные паттерны транскрипционной активности представителей одного семейства генов могут быть опосредованы работой дифференциальных регуляторных систем и запуском конкретных генных сетей в каждом случае. Для подтверждения данной гипотезы необходимы дальнейшие исследования с определением экспрессии всех паралогичных генов одного семейства. Поскольку изученная в данной работе относительная экспрессия генов не является концом сигнального пути, она не может быть индикатором определенного содержания АБК, но может указывать на изменения потенциала накопления данного фитогормона.

Sofia V. Bitarishvili

Russian Institute of Radiology and Agroecology

Author for correspondence.
Email: bitarishvili.s@gmail.com

Russian Federation, 109 km, Kievskoe shosse, Kaluga region, Obninsk, 249032

Jr Researcher, Laboratory of Radiobiology and Ecotoxicology of Plants

Vladimir S. Bondarenko

Russian Institute of Radiology and Agroecology

Email: bvs79@mail.ru

Russian Federation, 109 km, Kievskoe shosse, Kaluga region, Obninsk, 249032

PhD, Leading Researcher, Laboratory for the Study of the Effects of Agrocenoses Exposure to Non-ionizing Radiation

Stanislav A. Geras’kin

Russian Institute of Radiology and Agroecology

Email: stgeraskin@gmail.com

Russian Federation, 109 km, Kievskoe shosse, Kaluga region, Obninsk, 249032

Doctor of Science, Professor, Head of the Laboratory of Radiobiology and Ecotoxicology of Plants

  • Finkelstein R. Abscisic Acid synthesis and response. Arabidopsis Book. 2013;11:e0166. doi: 10.1199/tab.0166.
  • Christmann A, Weiler EW, Steudle E, Grill E. A hydraulic signal in root-to-shoot signalling of water shortage. Plant J. 2007;52(1):167-174. doi: 10.1111/j.1365-313X.2007.03234.x.
  • Deborah V, Malone RP, Dix PJ. Increased tolerance to abiotic stress in tobacco plants expressing a barley cell wall peroxidase. J Plant Sci. 2011;6(1):1-13. doi: 10.3923/jps.2011.1.13.
  • Козьмин Г.В., Гераськин С.А., Санжарова Н.И. Радиационные технологии в сельском хозяйстве и пищевой промышленности. – Обнинск: ВНИИРАЭ, 2015. [Koz’min GV, Geras’kin SA, Sanzharova NI. Radiatsionnye tekhnologii v sel’skom khozyaystve i pishchevoy promyshlennosti. Obninsk: VNIIRAE; 2015. (In Russ.)]
  • Битаришвили С.В., Волкова П.Ю., Гераськин С.А. Влияние γ-облучения семян на фитогормональный статус проростков ячменя // Физиология растений. – 2018. – Т. 65. – № 3. – С. 223–231. [Bitarishvili SV, Volkova PY, Geras’kin SA. γ-Irradiation of Barley Seeds and Its Effect on the Phytohormonal Status of Seedlings. Fiziologiia Rastenii. 2018;65(3):223-231. (In Russ.)]. doi: 10.7868/S0015330318030065.
  • Nambara E, Marion-Poll A. Abscisic acid biosynthesis and catabolism. Annu Rev Plant Biol. 2005;56:165-185. doi: 10.1146/annurev.arplant.56.032604.144046.
  • Tuan PA, Kumar R, Rehal PK, et al. Molecular Mechanisms Underlying Abscisic Acid/Gibberellin Balance in the Control of Seed Dormancy and Germination in Cereals. Front Plant Sci. 2018;9:668. doi: 10.3389/fpls.2018.00668.
  • ГОСТ 12038_84. Семена сельскохозяйственных культур. Методы определения всхожести. Межгосударственный стандарт. Стандарты на методы контроля. – М., 2002. [GOST 12038_84. Semena sel’skokhozyaystvennykh kul’tur. Metody opredeleniya vskhozhesti. Mezhgosudarstvennyy standart. Standarty na metody kontrolya. (In Russ.)]
  • Millar AA, Jacobsen JV, Ross JJ, et al. Seed dormancy and ABA metabolism in Arabidopsis and barley: the role of ABA 8’-hydroxylase. Plant J. 2006;45(6): 942-54. doi: 10.1111/j.1365-313X.2006.02659.x.
  • Bahin E, Bailly C, Sotta B, et al. Crosstalk between reactive oxygen species and hormonal signalling pathways regulates grain dormancy in barley. Plant Cell Environ. 2011; 34:980-993. doi: 10.1111/j.1365-3040.2011.02298.x.
  • Jarosova J, Kundu JK. Validation of reference genes as internal control for studying viral infections in cereals by quantitative real-time RT-PCR. BMC Plant Biol. 2010;10:146. doi: 10.1186/1471-2229-10-146.
  • Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT Method. Methods. 2001;25:402-408. doi: 10.1006/meth.2001.1262.
  • Гераськин С.А., Чурюкин Р.С., Казакова Е.А. Модификация развития ячменя на ранних этапах онтогенеза при воздействии γ-облучения на семена // Радиационная биология. Радиоэкология. – 2015. – Т. 55. – № 6. – С. 607–615. [Geras’kin SA, Chu rukin RS, Kazakova EA. Modification of Barley Development at Early Stages after Exposure of Seeds to γ-Irradiation dification of Barley Development at Early Stages after Exposure of Seeds to γ-Irradiation. Radiation biology, radioecology. 2015;55(6):607-615. (In Russ.)]. doi: 10.7868/S0869803115060065.
  • Волкова П.Ю., Чурюкин Р.С., Гераськин С.А. Влияние γ-облучения семян на активность ферментов в проростках ячменя // Радиационная биология. Радиоэкология. – 2016. – Т. 56. – № 2. – С. 1–7. [Volkova PY, Churyukin RS, Geras’kin SA. Influence of γ-Irradiated Seeds on the Enzyme Activity in Barley Seedlings. Radiation biology, radioeco logy. 2016;56(2):1-7. (In Russ.)]. doi: 10.7868/S0869803116020144.
  • Esnault MA, Legue F, Chenal C. Ionizing radiation: advances in plant response. Environ Exp Bot. 2010;68(3):231-7. doi: 10.1016/j.envexpbot.2010.01.007.
  • Huang GT, Ma SL, Bai LP, et al. Signal transduction during cold, salt, and drought stresses in plants. Mol Biol Rep. 2012;39:969-987. doi: 10.1007/s11033-011-0823-1.
  • Ishibashi Y, Aoki N, Kasa M, et al. The interrelationship between abscisic acid and reactive oxygen species plays a key role in barley seed dormancy and germination. Front Plant Sci. 2017;8:275. doi: 10.3389/fpls.2017.00275.
  • Ishibashi Y, Kasa S, Sakamoto N, et al. A role for reactive oxygen species produced by NADPH oxidases in the embryo and aleurone cells in barley seed germination. PLoS One. 2015;10(11): e0143173. doi: 10.1371/journal.pone.0143173.

Supplementary files

Supplementary Files Action
1. Fig. 1. Transcriptional activity of the gene HvNCED1 encoding the ABA biosynthesis enzyme in embryos depending on the dose of seed irradiation and incubation time in rolls with distilled water. 0 – no detection; *differences are statistically significant compared to control values, p < 0.05, Mann-Whitney U-test View (49KB) Indexing metadata
2. Fig. 2. Transcriptional activity of the gene HvABA8’OH-1 encoding the ABA catabolism enzyme in embryos depending on the dose of seed irradiation and incubation time in rolls with distilled water. * differences are statistically significant compared to control values, p < 0.05, Mann-Whitney U-test View (43KB) Indexing metadata

Views

Abstract - 21

PDF (Russian) - 20

PlumX


Copyright (c) 2018 Bitarishvili S.V., Bondarenko V.S., Geras’kin S.A.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.