IZMENENIE EKSPRESSII mRNK GENOV SINAPTIChESKIKh BELKOV V MOZGE DROSOPHILA MELANOGASTER S IZBYTOChNOY EKSPRESSIEY GENOV, MUTATsII V KOTORYKh OBUSLOVLIVAYuT RAZVITIE NEYRODEGENERATIVNYKh ZABOLEVANIY ChELOVEKA

Abstract



Full Text

Введение. В настоящее время для целого ряда нейродегенеративных заболеваний показано, что появление ранних клинических симптомов происходит в отсутствии каких-либо признаков амилоидоза или нейрофибриллярной дегенерации и коррелирует лишь с потерей или дисфункцией синапсов. Этот феномен был отмечен при БА, болезни Гентингтона, прионных болезней; боковом амиотрофическом склерозе. Аналогичные результаты наблюдали и для трансгенных животных, моделирующих прионную болезнь, БА, болезнь Гентингтона. Удивительно, что во всех представленных моделях дисфункция синапсов сопровождалась нарушением тех когнитивных функций, которые характеризуют наиболее ран ние симптомы заболевания. Эти результаты позволяют предположить существование общих молекулярных и клеточных механизмов нейродегенеративных заболеваний, связанных непосредственно с дисфункцией или потерей синапсов. В данной работе мы исследовали уровень экспрессии генов, кодирующих синаптические белки синаптотагмин и синаптобревин, при экспрессии в нервных клетках мозга Drosophila melanogaster гена АРР человека, мутации в котором приводят к развитию семейных форм болезни Альцгеймера. Материалы и методы исследования. Линии и условия содержания мух. Трансгенные линии Drosophila melanogaster, использованные в работе, 82 МЕДИЦИНСКИЙ АКАДЕМИЧЕСКИЙ ЖУРНАЛ, 2012 г., ТОМ 12, № 4 получены из коллекции Drosophila Bloomington Stock Center. Использованы следующие линии: UAS-APP (далее в тексте APP), несущая гена APP человека; UAS-APP-Swedish (далее в тексте APP-Sw), несущая ген APP с мутацией Swedish (670K3N, 671M3L), приводящей к наследственной форме БА; UAS-APPANT (далее в тексте APPANT), со дер -жит последовательность, кодирующую укороченную форму гена APP (трансмембранный домен и цитоплазматический хвост), UAS-APPA^ (далее в тексте APPAСT), содержит последовательность, кодирующую укороченную форму гена APP, в которой удалена большая часть цитоплазматического конца, UAS-BACE (далее в тексте BACE), содержащая ген бета-секретазы человека. Все вышеперечисленные гены экспрессированы в нервных клетках Drosophila с помощью тканеспецифического активатора транскрипции GAL4-elavc155 (далее elav). Для определения уровня экспрессии исследуемых генов мы брали 2- и 30-дневных мух - потомков от скрещивания самок, экспрессирующих elav и elav;BACE, и самцов, экспрессирующих APP и его формы. Во время проведения экспериментов мухи содержались на стандартной дрожжевой среде при температуре 29° С при 12-часовом световом дне. Выделение РНК. Для выделение РНК брались 40 голов мух нужного генотипа. Выделение проводилось с помощью набора фирмы-производителя Zymo Research ZR Tissue & Insect RNA MicroPrep™ согласно протоколу. Обратная транскрипция. Для реакции бралось 5 мкл выделенной РНК, 1 мкл праймеров Oligo(dT)18 Primer (Fermentas) и 6 мкл воды двойной дистилляции. Полученная смесь икубировалась 5 минут при температуре 70° С, затем к смеси добавляли 1мкл RiboLock RNase Inhibitor (Fermentas), 4 мкл буфера 5 Reaction Buffer for M-MuLV RT (Fermentas) и 2 мкл смеси 10 mM dNTP Mix (Fermentas). Полученную смесь инкубировали при 37° С 5 минут после чего добавляли 1 мкл обратной транскриптазы RevertAid M-MuLV RT (Fermentas) и продолжили инкубировать при 37° С в течение часа. По истечении часа смесь инкубировали 10 мин при 70° С для остановки процесса. Проведение ПЦР в реальном времени. Определение уровня экспрессии мРНК генов sytl, n-syb проводилось методом количественной ПЦР в режиме реального времени с флюоресцентными зондами TaqMan на приборе ABI7000 Prism. Оценка экспрессии генов и референс-гена была проведена с использованием разработанных нами с помощью программы PrimerExpress зондов TaqMan. В качестве референс-гена был использован ген RP-49 (рибосомальный протеин L32). В качестве флюоресцентной метки зонда для кДНК гена RP-49 использовался краситель R6G, зонда для кДНК генов sytl и n-syb - FAM. Полученные данные нормированы относительно контрольной линии, экспрессирующей ген elav. Для амплификации соответствующих фрагментов исследуемых генов подобраны следующие праймеры и пробы: sytl: fwd - CCTGGTCAGCGTT GAAG-GA, rev - GCAGCGAGAAGCAGATATCT, probe - FAM-AGGGCGGACAGGAAA-RTQ1; n-syb: fwd - GGCGGCGTGTAAGCAATC, n-syb rev - CCCGCTGAAGGAGCACACTA, n-syb probe - FAM-CGCTGCCAGGAC-GAAAGTTTCTCGA-RTQ1; PSN: fwd -TGGACTGCC TGGGCTGTA, rev -TCCTCTTGGCGAAAGGACA, probe - FAM-CTGCCATTTCTATTTGGGATCTT-RTQ1; RP49: fwd - AGCACTTCATCCGCCACC, rev - CGACGCACTCTGTTGTCG, probe -R6G-CTAAGCTGTCGCACAAATGGCG-BHQ1; Для достижения точности результатов, снижения уровня ошибки, ПЦР в реальном времени для двух генов (анализируемый ген и ген-референс) проводили в одной пробирке, с использованием разных флю-орогенных меток (FAM и RG6). Статистическая обработка данных. Статистический анализ был проведен с использованием программы KyPlot версии 2.0. Статистический анализ проводили с помощьюкритерия множественных сравнений Тьюки-Крамера. Статистическая значимость учитывалась при р<0,05. Данные представлены в виде среднего ± ст. ошибка среднего. Результаты и их обсуждение. Болезнь Альцгеймера (БА) - одно из самых распространенных ней-родегенеративных заболеваний, проявляющееся в виде прогрессирующей деменции и нарушении когнитивных функций, таких как речь, внимание, мышление, психомоторная координация, ориентация и др. [1]. Основной гистопатологической маркер Б А -отложение в мозге пациентов так называемых сенильных бляшек, состоящих в основном из амилои-да-в-протеина (Абета), который является продуктом протеолиза большого трансмембранного белка АРР (белок, предшественник амилоида). Однако последние исследования БА показывают частое отсутствие корреляции между количеством амилоид -ных бляшек и степенью деменции пациентов с БА, что предполагает наличие альтернативных путей развития БА, не зависящих от Абета. В то же время деградация когнитивных функций и умственных спо- МЕДИЦИНСКИЙ АКАДЕМИЧЕСКИЙ ЖУРНАЛ, 2012 г., ТОМ 12, № 4 83 собностей пациентов согласуется с изменением сина- Значения уровня мРНК гена sytl и n-syb, нормиптической плотности в отделах головного мозга [2], рованное на соответствующие показатели для рефе-что дает основание рассматривать подобное измене- ренсного гена RP-49, на 2-й и на 30-й день, предние как один из первичных признаков БА. ставлены в таблице. Т аблица Уровень экспрессии мРНК синаптических генов, при экспрессии АРР человека Г енотипы линий Возраст мух 2-й день 30-й день sytl n-syb sytl n-syb elav 1,00±0,23 1±0,17 1,00±0,15 1±0,14 elav;APP 0,12+0,02** 0,43+0,03** 0,40+0,12** 0,61+0,05* elav ;APP-Swedish 0,13+0,02** 0,36+0,08** 0,57+0,08* 0,40+0,13* elav;APP4CT 0,45±0,12* 0,69±0,02 0,69±0,11 0,69±0,19 elav;APP4NT 0,30+0,01** 0,46+0,13** 0,71+0,15 1,02+0,09 elav ;APP /ВACE 0,11+0,02** 0,31+0,04** 0,54+0,19* 0,96+0,09 elav ;BACE;APP-Swedish 0,18±0,03** 0,17±0,07** 0,63±0,07* 1,10±0,07 * Статистически достоверные различия, р<0,05; ** статистически достоверные различия, р<0,001. В процессинге APP человека участвуют две проте-азы, получившие названия бета- и гамма-секретаз. Стоит отметить, что геном плодовых мушек содержит ортолог АРР человека, APPL, однако кодируемый им белок не включает в себя последовательности Абе-та. Также у Drosophila представлены все компоненты белкового комплекса, ответственного за активность гамма-секретазы, а активность бета-секретазы либо отсутствует, либо сведена к минимуму [3]. Таким образом, одновременная экспрессия генов APP и бе-та-секретазы человека в Drosophila позволяет моделировать один из основных признаков БА -накопление амилоида. В то же время экспрессия гена APP без экспрессии бета-секретазы позволяет оценить эффект экспрессии самого APP, не связанный с токсическими эффектами, обусловленными Абета. Для исследования изменения уровня мРНК мы брали 2- и 30-дневных мух следующих генотипов: elav (в качестве контроля), elav;APP, elav;APP-Swedish, elav;APPACT, elav;APPANT, elav;APP/BACE и elav;BACE;APP-Swedish. Полученные данные по измерению уровня экспрессии мРНК гена sytl демонстрируют его существенное статистически значимое снижение уже на второй день жизни мух во всех исследованных трансгенных линиях. Подобная же картина сохранялась и для мух на тридцатый день их жизни, за исключением линии, экспрессирующей укороченные формы APPACT и APPANT, для которых, несмотря на уменьшение значений уровня экспрессии, не наблюдалось статистически достоверных изменений. Мы также наблюдали снижение уровня экспрессии мРНК гена n-syb. На второй день статистически значимое уменьшение уровня экспрессии мы наблюдали для всех линии, однако на тридцатый день жизни мух статистически значимое уменьшение было зафиксировано только для линий, экспрессирующих APP и его мутантную форму APP-Swedish. В линиях, где образовался Абета, снижение уровня мРНК гена n-syb не наблюдалось. Таким образом, мы показали, что изменение уровня экспрессии мРНК генов синаптических белков при БА может идти независимо от Абета.

About the authors

N A Tkachenko

Email: n.tkachenko@me.com

D I Rodin

S V Sarantseva

References

  1. Боева Е. М., Бориневич В. В., Вейн А. М. Справочник невропатолога и психиатра.- 2 изд., перераб. и доп.- М.: Медицина, 1968.
  2. Terry R. D., Masliah E., Salmon D. Physical basis of cognitive alterations in alzheimer s disease: Synapse loss is the major correlate of cognitive impairment // Annals of Neurology.- 1991.- Vol. 30.- Р. 572-580.
  3. Fossgreen A. et al. Transgenic Drosophila expressing human amyloid precursor protein show Y-secretase activity and a blistered-wing phenotype // Cell Biology.- 1998.- Vol. 95.- Р. 13703-13708.

Statistics

Views

Abstract - 33

PDF (Russian) - 2

Cited-By


PlumX

Refbacks

  • There are currently no refbacks.

Copyright (c) 2012 Tkachenko N.A., Rodin D.I., Sarantseva S.V.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies