Serotonin transporter gene 5-HTTLPR VNTR allele frequency distribution in Africa and Eurasia

Cover Page

Abstract


Background. VNTR-polymorphism at 5 HTTLPR regulatory region of human serotonin transporter gene SLC6A4, which is associated with some psychiatric diseases and personality traits, is presented by two alleles, S and L, affecting the gene transcription level. A correlation between the S allele frequency in populations of European and Asian origin and a Hofstede’s individualism-collectivism index was revealed and a hypothesis of culture-gene coevolution was suggested (Chiao, Blizinsky, 2010). Methods. As another reason for the correlation we examined underlying population genetic substructure, which may affect genetic association level. Results. We have experimentally established the 5 HTTLPR genotypes for 2144 individuals to calculate S and L allele frequencies in 21 populations of Eurasia and Africa. In contrast to Eurasia populations, we have found low S allele frequencies in all four African populations studied, although the collectivism index in the populations was high. The total set of Eurasian and African populations analysis does not confirm the correlation (R= 0.263, p=0.146). We have applied principal component (PC) analysis to check a correlation between S allele frequency distribution and a frequency distribution for alleles which are supposed to be neutral. PC analysis for 68 alleles of five CODIS STR loci revealed correlation between PC2 and S allele frequency (R= 0.820, p<0.0001). The correlation means that S allele frequency distribution corresponds to general genetic variability distribution in the human populations studied. The correlation between the Hofestede’s index and frequency of four out of 68 STR alleles is even higher than the correlation with S allele frequency in the same populations. Conclusion. Our findings do not support the hypothesis on culture-gene coevolution of “individualism-collectivism” and the S allele frequency of serotonin transporter gene.

Full Text

ВВЕДЕНИЕ В исследованиях ассоциации генов с рядом психологических особенностей и психических заболеваний значительное внимание уделяется ген-средовым взаимодействиям. Один из наиболее изученных в этом отношении генов - ген транспортера серотонина SLC6A4. Серотонин (5-гидрокситриптамин, 5-HT) является нейромедиатором, участвующим в регуляции многочисленных физиологических процессов, в том числе питания, сна, тонуса сосудов, двигательной активности и других функций (Sanders-Bush, Mayer, 2006). Транспортер серотонина (ТС) локализован в мембране пресинаптических нейронов и осуществляет обратный захват серотонина и его транспорт из синтаптической щели в пресинаптический нейрон. От уровня активности ТС зависит концентрация серотонина и продолжительность его воздействия на рецепторы в мембране постсинаптического нейрона. Эффективность передачи нервного импульса серотонинэргическими нейронами влияет на риск развития психических заболеваний. Помимо этого серотонин опосредует связь нервной и иммунной систем (Baganz, Blakely, 2013). ТС является мишенью ряда антидепрессантов (прозак и др.), подавляющих его активность, что приводит к повышению концентрации серотонина в синаптической щели. Транспортер серотонина кодируется геном SLC6A4 (Soluble carrier family 6, member 4, альтернативное название 5-Hydroxytryptamine transporter, 5-HTT, идентификатор OMIM 182138). Ген расположен в локусе 17q11.1-q12 (Ramamoorthy et al., 1993). В промоторе гена имеется полиморфный участок с варьирующим числом повторяющихся элементов размером 21-22 п. н., обозначаемый как 5-HTTLPR (the 5-HTT gene-linked promoter region). «Короткий » аллель S содержит 14 повторов и отличается от «длинного» аллеля L делецией 44 п. н., затрагивающей участок с 6 по 8 повторы, и более низким уровнем транскрипции. Генотип L/L обеспечивает удаление серотонина из синаптической щели в 1,9-2,2 раза более интенсивное, чем варианты S/S и S/L (Heils et al., 1996; Lesch et al., 1996). Транспортер серотонина был одним из первых генов, для которого была показана ассоциация с психологическим характеристиками индивидов, такими как тревожность и нейротизм. При этом вклад генотипа в вариабельность признака оценен как объясняющий 3-4 % общей вариабельности и 7-9 % генетически детерминированной вариабельностои (Lesch et al., 1996). 5-HTTLPR ассоциирован с рядом психических заболеваний (депрессия, биполярное расстройство, посттравматическое стрессовое расстройство, суицидальное поведение, алкогольная и никотиновая зависимость и др.). В серии исследований показана асоциация аллеля S с тревожностью, биполярным расстройством, попытками суицида и более высоким уровнем активации миндалины, тогда как для аллеля L имеются указания на ассоциацию с никотиновой зависимостью и синдромом гиперактивности с нарушением внимания (см. обзор Kenna et al., 2012). Для депрессии получены противоречивые данные которые, возможно, могут быть интерпретированы при анализе ген-средовых взаимодействий и учета того, что ассоциация аллелей HTTLPR с заболеванием может модерироваться условиями среды. При наличии стрессирующих жизненных событий в истории жизни индивида носители генотипа аллеля S чаще указывают на наличие депрессии, чем носители генотипа L/L. В благоприятных условиях, при отсутствии стрессирующих событий, ассоциация этого полиморфизма с риском депрессии в цитируемом исследовании выявлена не была (Caspi et al., 2003). Это исследование привлекло значительное внимание (более 3000 цитирований) и вызывало попытки проверить выявленные эффекты. В ряде работ эффект был подтвержден, тогда как в других ассоциация аллелей полиморфизма HTTLPR с тревожностью или депрессией не была выявлена ни в связи с неблагоприятными жизненными событиями, ни без этой связи (Caspi et al., 2010). В исследовании пострадавших от урагана во Флориде продемонстрировано влияние таких условий среды, как уровень преступности и уровень безработицы, на риск развития посттравматического стрессового расстройства. В неблагоприятных условиях среды (при высоком уровне преступности или безработицы) более высокий риск развития постравматического стрессового расстройства выявлен у носителей генотипа S/S, а в благоприятных условиях (при низком уровне указанных факторов) - у носителей генотипа L/L (Koenen et al., 2004). Недавно проведенный мета-анализ 54 исследований, включавших 40749 индивидов, подытожил эти исследования и показал, что условия среды (наличие стрессов) статистически значимо влияют на ассоциацию аллеля S с повышенным риском развития депрессии (Karg et al., 2011). В этом исследовании также указано, что отсутствие ассоциации аллеля S с риском развития депрессии в ранее проведенных мета-анализах (Munafo et al., 2009; Risch et al., 2009) связано с отличиями в формировании выборки для проведения мета-анализа. Носители более эффективно транскрибируемого L-аллеля демонстрируют более высокий субъективный уровень удовлетворенности жизнью, устанавливаемый по опросникам (число исследованных индивидов 2545, p = 0,012) (De Neve et al., 2012). Однако попытка тех же авторов подтвердить выявленную ассоциацию на независимых выборках была неуспешна (De Neve et al., 2012), но на небольшой выборке японцев (92 индивида) ассоциация подтвердилась (Matsunaga et al., 2013). У китайцев с тревожностью оказался ассоциирован не S-аллель, а L-аллель (Long et al., 2013), что может указывать на этноспецифичность ассоциации, которая может зависеть как от генетического фона, так и от особенностей социокультурной сферы. С этой работой перекликаются результаты межпопуляционного анализа ассоциации суицидов с аллелями 5-HTTLPR для 38 стран, показавшего, что в европеоидных популяциях аллель S действует как протективный фактор, а в неевропеоидных - как рисковый (Schild et al., 2014). Связь гена транспортера серотонина с психическими особенностями привела к попытке найти корреляции между культурными особенностями обществ и частотой аллеля S в представляющих их популяциях. Такое исследование было проведено психологом Дж. Чао и аспирантом-нейробиологом К. Близински, которые обнаружили корреляцию между частотой аллеля S и коллективизмом - культурной характеристикой общества, установленной голландским социологом Г. Хофстедом по данным социологических опросов и противопоставляемой индивидуализму. Частота аллеля S также коррелировала с более низкой тревожностью и распространенностью аффективных расстройств (уровень которых в исследованных коллективистических культурах действительно ниже). На основе выявленной корреляции авторы предположили, что эволюция культурных ценностей (индивидуализма-коллективизма) может быть связана с генами (частотами аллелей 5-HTTLPR) (Chiao, Blizinsky, 2009). Эта работа получила значительную критику как от специалистов в кросс-культурных исследованиях (Minkov, 2011, стр. 42), так и генетиков (Eisenberg, Hayes, 2011). При корреляционном анализе Чао и Близински не проконтролировали независимость включенных в исследование групп. По сути, вместо декларированных Чао и Близински 29 наций (популяций) необходимо рассматривать все случаи как две группы - европейцы и азиаты, поскольку выявленная корреляция обеспечена различием частот аллеля S именно между этими двумя группами. В группах европейского происхождения частота аллеля S составляет от немногим менее 40 % до 55-60 %, а в азиатских группах (Китай, Тайвань, Корея, Сингапур и Япония) - выше 60 %. Внутри этих групп корреляция статистически незначима, а при исключение отдельных групп (например, исключении Турции из группы европейских стран) меняется на противоположную (Eisenberg, Hayes, 2011). Для того чтобы проверить, отражают ли межпопуляционные различия частот аллелей 5-HTTLPR общую изменчивость генетической структуры популяций, или сформированы под влиянием каких-либо иных факторов, Эйзенберг с соавт. использовали стандартный прием - анализ корреляции частот аллеля S с главными компонентами (PC1 и PC2), отражающими изменчивость частот аллелей 197 146 генетических маркеров, изученных в европейских популяциях (Novembre et al. 2008). Для 14 европейских популяций из тех 29, что были исследованы Чао и Близински, доступны данные по генетическим маркерам из статьи Новембра с соавт. (Novembre et al. 2008). Как показано Эйзенбергом, частота аллеля S коррелирует с PC1 с высоким уровнем значимости (r = 0,81, p = 0,0005), и эта корреляция не исчезает при исключении отдельных популяций из исследуемой выборки (Eisenberg, Hayes, 2011). Таким образом, Чао и Близински из-за некорректного формирования исследуемой выборки и отсутствия должного контроля генетической дифференциации популяций сделали заключение о ген-культурной коэволюции частот аллелей гена транспортера серотонина и индивидуализма-коллективизма, которое полученные ими результаты не подтверждают. Вслед за публикацией (Chiao, Blizinsky, 2009) появились аналогичные исследования, в которых частоты аллелей в популяциях сопоставляются с культурными характеристиками обществ (Way, Lieberman, 2010; Bisso-Machado et al., 2013), при этом справедливые критические замечания (Eisenberg, Hayes, 2011) в отношении исходной статьи авторами более поздних публикаций не учтены. Анализ соответствия распределения частоты аллеля S генетической структуре популяций проведен Эйзенбергом лишь для 14 европейских популяций, для которых были доступны данные и для частот аллеля S, и для генетических маркеров из статьи (Novembre et al. 2008). Мы исследовали географическое распределение частот аллелей 5-HTTLPR в популяциях Африки и Евразии на основе собственных и опубликованных данных для населения 50 стран, для 7 из которых частоты аллелей были установлены нами впервые. Для того чтобы определить, в какой мере распределение частот аллелей 5-HTTLPR отражает общую географическую изменчивость генетической структуры популяций, мы использовали STR-маркеры применяемой в криминалистике системы CODIS. В настоящее время накоплены генетические данные по множеству маркеров (вплоть до полных геномов) для многих популяций мира. Однако данные для системы CODIS, применяемой в криминалистике, в ряде случаев доступны даже для тех стран, в которых другие гены не изучены. Частоты аллелей именно этого типа локусов могут служить контролем в набирающих популярность кросс-культурных исследованиях, пытающихся оценить влияние генетических особенностей населения на социальные и культурные характеристики обществ. В данной работе представлены результаты исследования особенностей географического распределения частот аллелей по полиморфизму 5-HTTLPR в промоторном участке гена траспортера серотонина SLC6A4 в популяциях России и мира на основе собственных экспериментальных данных и ранее опубликованных. При анализе корреляции частоты аллеля S с главными компонентами, рассчитанными по частотам 68 аллелей 5 STR-локусов системы CODIS показана значимая корреляция с PC2, что указывает на соответствие межпопуляционных различий в частоте аллеля S общей изменчивости генетической структуры популяций. Частоты аллелей CODIS доступны для многих популяций, мало изученных по остальным локусам и могут служить контролем в набирающих популярность кросс-культурных исследованиях, пытающихся оценить влияние генетических особенностей населения на социальные и культурные характеристики обществ. МАТЕРИАЛЫ И МЕТОДЫ В работе были использованы коллекции биологических образцов, представляющие популяции различных географических регионов (венозная кровь либо соскобы с внутренней поверхности щеки), полученных от 1776 индивидов, представляющих русских (Санкт-Петербург и Ленинградская область), украинцев (Восточная Украина), белорусов (различные регионы Беларуси), башкир, татар, чувашей и кабардинцев, а также у 245 студентов московских вузов - жителей 13 стран Евразии и Африки. Все образцы крови были собраны у неродственных индивидов с соблюдением принятой в мире процедуры «информированного согласия» и сбором данных о месте рождения. При формировании коллекций, представляющих российские этнические группы, помимо сбора данных о месте рождения проводился опрос о национальной принадлежности предков двух поколений, и в исследуемые выборки включались только лица, имеющие предков соответствующей национальной принадлежности на основе данных опроса. Выделение геномной ДНК из 10 мл венозной крови осуществляли с помощью наборов DNA-prep (фирма «Изоген», Москва). Генотипирование аллельного состояния полиморфизма 5’-HTTLPR проводили по (Lazary et al., 2008) с модификациями, с помощью ПЦР-амплификации с праймерами SLCFor: CCCTCCTGGAAAGGACACTT SLCRev: GTAGGGTGCAAGGAGAATGC Для проведения ПЦР использовали готовые наборы «Core» (фирма «Изоген», Москва). В реакционную смесь вносили по200 мкМ каждого dNTP, по 0,1 мкМ каждого праймера, 30-100 нг геномной ДНК и 1 ед. активности Taq-полимеразы. Амплификацию проводили в следующем режиме: 1 мин. 95 °С, затем 35 циклов с чередованием 94 °С, 61 °С, 72 °С по 30 сек. при каждой температуре, с завершающим прогреванием 10 мин. при 72 °С. Реакцию проводили в детектирующем амплификаторе «ДТ-322» (ООО «НПО ДНК-Технология», Россия). Полученные фрагменты ДНК разделяли в 2 %-м агарозном геле. Для сбора данных о частотах аллелей 5’-HTTLPR в популяциях мира был проведен поиск статей в базах данных PubMed (PubMed 25.10.2013) и в Научной электронной библиотеке (elibrary. ru 25.10.2013), а также были собраны ссылки из выявленных обзорных статей по теме исследования. Поиск проводился по запросу «HTTLPR» или «SLC6A4» или «serotonin transporter» в сочетании с «allele frequency». Найдено 630 статей, из которых было отобрано 102 статьи, содержавших сведения о частотах аллелей в 164 популяциях, для которых были доступны сведения об этнической принадлежности или стране происхождения и географическом положении. Для построения карты были отобраны по одной-две выборки, представляющих население различных стран или этнические группы. Для стран с большим населением и территорией (Китай, Индия, Нигерия, Россия) использовали большее число выборок. При наличии нескольких публикаций для одной группы отбирали выборку большей численности. Для построения карты использовали программный пакет Surfer 8.00 (Golden Software). Источником данные о частотах аллелей STR-маркеров послужили базы данных (Database for autosomal short tandem repeats, 25.10.2013; ALFRED, 25.10.2013; The Distribution of the Human DNA-PCR Polymorphisms,10.01.2014). Для российских популяций использованы данные из статьи (Степанов и др., 2011). Для анализа были выбраны локусы, для которых доступны данные для большинства включенных в исследование популяций (FGA, vWA, TH01, D3S1358, D8S1179). Показатели индивидуализма-коллективизма для включенных в исследование стран по Хофстеду приведены по базе данных Хофстедовского центра (The Hofstede Centre, 12.02.2014). Статистические оценки проводили с помощью критерия χ2 (Roff et al., 1989) и точного теста (Elston, Forthofer, 1977). Коэффициент корреляции (двусторонний тест, по Пирсону) рассчитывали с помощью программного пакета SPSS 14.0. РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ Установлены частоты генотипов и аллелей у 1899 индивидов, представляющих популяции России (русские, украинцы, белорусы, татары, башкиры, чуваши, кабардинцы), Украины и Беларуси, у 245 студентов московских ВУЗов - жителей африканских стран (Ангола, Гана, Кот-д'Ивуар, Нигерия, Танзания), арабских стран Ближнего Востока (Иордания, Ирак, Ливан, Палестина, Сирия), а также Албании, Монголии и Непала. Частоты генотипов и аллелей приведены в таблице 1. Наблюдаемое распределение генотипов в изученных популяциях согласно соответствует ожидаемому при равновесии Харди-Вайнберга. Частота аллеля S, обуславливающего более низкий уровень экспрессии гена транспортера серотонина, в африканских популяциях ниже, чем в каких-либо других регионах мира. В изученных нами группах она варьирует от 20,0-23,8 % в Анголе, Нигерии и Танзании до 34,6 % и 37,5 % у жителей Кот-д’Ивуар и Ганы (табл. 1). Установленная нами частота аллеля S в населении Танзании 23,8 % близка опубликованным данным для хадза и чагга Танзании - 21,0 % (Butovskaya et al., 2012) и 22 % (Murdoch et al., 2013), а в Нигерии (21,6 %) - к опубликованным данным для йоруба (21,4 %) (Murdoch et al., 2013). Согласно опубликованным данным, низкая частота аллеля S - от 13 до 23 % выявлена и у негров США (Lotrich et al., 2003), у коренного населения ЮАР (Esau et al., 2008), где частота аллеля S составила 16,2 %, и в других популяций южнее Сахары (7-20 %) (Murdoch et al., 2013). Более высокие цифры для КотД’Ивуар и Ганы могут отражать повышение частот аллеля S в западных регионах Африки, однако размеры изученных выборок слишком малы, чтобы сделать окончательное заключение. Для населения арабских стран частота аллеля S варьирует от 34 % до 50 % согласно установленным нами и опубликованным данным (Nasserddine et al., 2012; Murdoch et al., 2013). Установленная нами частота 41,7 ± 0,082 % для арабов Иордании в выборке 18 индивидов не отличается значимо от опубликованных данных для той же популяции - 47,8 % (230 индивидов) (Al-Eitan et al., 2012). Близкая частота у израильтян (47 %) (Manor et al., 2001), иранцев (51 %) (Farjadian et al., 2013). В большинстве европейских популяций частота аллеля S колеблется между 36 % (итальянцы, поляки) и 43- 45 % (румыны, чехи, австрийцы, шведы). Установленная нами частота для русских Санкт-Петербурга (38,5 %) близка к опубликованным данным для русских Вологды (36,2 %) и Архангельска (40.9 %) (Murdoch et al., 2013). В популяциях Волго-Уральского региона частота достигает 48-50 % (чуваши, татары, башкиры). При этом установленные нами частоты для татар, башкир и чувашей (48, 50 и 50%, соответственно) практически совпадают с независимо опубликованными данными для тех же популяций (49,7 %, 50,4 % и 48,8 %) (Noskova et al., 2008; Murdoch et al., 2013). У сибирских эскимосов частота аллеля S составляет 45 % (Bisso-Machado et al., 2013), тогда как у хантов и якутов - 75,5 % и 81,4 % (Murdoch et al., 2013). Для остального населения Сибири и Дальнего Востока частота этого аллеля остается неизвестной. В популяциях Восточной Азии частота аллеля S превышает 70 % у китайцев и тайцев, и близка к 80 % у корейцев и японцев (табл. 2). Лишь в одной статье указаны гораздо более низкие частоты аллеля S - у малайцев 23,5 % (выборка 49 человек), китайцев Малайзии - 0 (8 человек) и индийцев Малайзии - 42,9 % (7 человек) (Saini et al., 2013). Так как для китайцев и индийцев в многочисленных других публикациях указаны намного более высокие цифры, можно предположить, что цитируемая работа содержит техническую ошибку либо отличия обусловлены малым размером изученных выборок. В Индии частота аллеля ниже, чем в Восточной Азии, но выше, чем в Европе - от 60 % до более 70 % в разных регионах (Guhathakurt et al., 2006; Tibrewal et al., 2010). Определенные нами частоты аллеля S для очень небольших выборок, представляющих население Монголии (77,3 %, 11 человек) и Непала (64,3 %, 14 человек) соответствуют описанному географическому градиенту частот этого аллеля в Евразии. Для нескольких популяций индейцев Северной, Центральной и Южной Америки установлены частоты алелля S от 49 до 75,2 % (Bisso-Machado et al., 2013; Murdoch et al., 2013). Исключение составляют две малочисленные южноамериканские группы (суруи и каритиана) с более низкой частотой этого аллеля - около 30 % (Murdoch et al., 2013). Небольшое количество исследованных популяций не позволяет установить закономерности распределения частот аллелей гена транспортера серотонина для этого региона. Географическое распределение частоты аллеля S в популяциях Африки и Евразии представлено на карте (рис. 1). Карта построена на основе частот аллеля S в 90 популяциях, представляющих 50 стран (включая 16 популяций, исследованных в данной работе) (табл. 2). Для того чтобы определить, в какой мере распределение частот аллелей 5-HTTLPR отражает общую географическую изменчивость генетической структуры популяций, мы использовали STR-маркеры применяемой в криминалистике системы CODIS. В принятой в качестве стандарта для ДНК-идентификации в криминалистических исследованиях в США и ряде других стран системе CODIS используется 13 STR-локусов (CSF1PO, FGA, THO1, TPOX, VWA, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51, D21S11), с добавлением еще двух локусов системы Identifiler, принятой в Европе (D2S1338, D19S433). Аллели этой системы считаются нейтральными. К настоящему времени опубликованы частоты аллелей этих локусов для десятков популяций различных стран. При этом в последние годы публикуются данные для всего набора CODIS, а в более ранних публикациях исследовались отдельные локусы. Поэтому для различных стран и популяций доступны частоты аллелей различных локусов. Среди исследованных нами популяций, для которых известны частоты алеллей 5-HTTLPR, для населения 30 стран доступны данные для пяти локусов системы CODIS (FGA, vWA, TH01, D3S1358, D8S1179, всего 68 аллелей), и еще для 3 стран - по четырем из них (всего 57 аллелей, за исключением локуса D8S1179,). На основе частот аллелей этих локусов были рассчитаны главные компоненты. При расчете по 5 локусам для 30 стран PC1 объясняет 24,6 % общей изменчивости, а PC2 - 13,9 %, PC3 - 9,0 %. Коэффициент корреляции частот аллеля S c PC1 составил R = 0,280 при p = 0,134, для PC2 R = -0,820 при p < 0,0001. Корреляция частоты аллеля S с PC2 указывает на соответствие межпопуляционных различий в частоте аллеля S общей изменчивости генетической структуры популяций. Для того чтобы оценить, в какой мере уникальная выявленная Чао и Близински корреляция частоты аллеля S, детерминирующего более низкий уровень экспрессии гена транспортера серотонина, с индексом индивидуализма-коллективизма по Хофстеду, мы воспроизвели проведенный ими анализ на расширенной выборке стран Евразии и Африки, а также исследовали корреляцию частот 58 аллелей локусов CODIS с этим индексом. Из 33 стран нашей выборки, для которых доступны частота аллелей CODIS, для 32 стран доступны также данные об индексе индивидуализма-коллективизма. Также, как у Чао и Близински, для стран Евразии обнаруживается корреляция частот аллеля S (27 стран, R = 0,557, p = 0,003). Однако при включении в выборку еще и 5 стран Африки корреляция становится незначимой (R = 0,263, p = 0,146). При этом как для стран Африки и Евразии, так и для подгруппы евразийских стран выявлены аллели STR- локусов системы CODIS с более высоким уровнем корреляции их частот с индексом индивидуализма-коллективизма, чем для аллелей 5-HTTLPR. В группе 27 евразийских стран для 16 из 68 аллелей системы CODIS выявлены корреляции (p < 0,05) с индексом индивидуализма-коллективизма, при этом для 4 из этих аллелей корреляция остается значимой (p < 0,0007) с учетом поправки Бонферрони, в отличие от частоты аллеля S локуса 5-HTTLPR, корреляция с которой поправку на множественное тестирование в данном испытании не выдерживает. Аналогичные результаты получены при включении в исследуемую выборку стран Африки. Корреляции с 4 из 68 аллелями локусов системы CODIS остаются значимыми после поправки Бонферрони, два из этих аллелей - те же, что и для евразийской группы стран. Наиболее значимые корреляции приведены в таблице 3, а сопоставление распределения частот аллелей с индексом индивидуализма-коллективизма представлено на рисунке 2. Так же как и для аллеля S, аллели CODIS, для которых получены значимые корреляции с индексом индивидуализма-коллективизма, по частоте коррелируют с PC2, то есть их распределение отражает основные тенденции на геногеографической карте, сформированные процессами миграций, генетического дрейфа и потока генов между популяциями. Корреляция с PC2 является указанием на то, что именно популяционная структура является детерминантом распределения частот этих аллелей в Евразии. Корреляция почти четверти из произвольно выбранных аллелей с исследуемым признаком (индексом индивидуализма-коллективизма) поддерживает предположение, что такая корреляция не является причинной ни для этих аллелей, ни для аллеля S. Для обоснования гипотез о ген-культурных взаимодействиях недостаточно корреляционного анализа, необходим более детальный анализ, пример которого приведен в исследованиях группы проф. Анны ди Риензо (Hancock et al., 2010). Таким образом, в проведенном исследовании установлены частоты аллелей локуса 5-HTTLPR для 21 популяции 14 стран, построена карта географического распределения частот аллеля S локуса 5-HTTLPR, и показано, что распределение частот аллеля S детерминируется генетической структурой популяций Африки и Евразии. Для контроля генетической структуры популяций использованы частоты аллелей локусов системы CODIS, которые доступны для популяций, малоизученных по другим локусам. Показано, что частота аллеля S, детерминирующего более низкий уровень экспрессии гена транспортера серотонина, коррелирует с индексом индивидуализма-коллективизма по Хофстеду в выборке 28 стран Евразии (R = 0,557, p = 0,003), также, как в цитированной статье Чао и Близиински (Chiao, Blizinksy, 2010). Однако при добавлении 4 стран Африки корреляция становится незначимой (R = 0,263, p = 0,146). При этом как для стран Африки и Евразии, так и для подгруппы евразийских стран выявлены аллели STR-локусов системы CODIS с более высоким уровнем корреляции их частот с индексом индивидуализма-коллективизма, чем для аллелей 5-HTTLPR. Полученные данные демонстрируют возможность применения системы CODIS для контроля вклада популяционной структуры в набирающих популярность кросс-культурных исследованиях, пытающихся оценить связь генетических особенностей населения с социальными и культурными характеристики обществ.

About the authors

Aleksey Sergeyevich Gureyev

Vavilov Institute of General Genetics RAS

Email: alexy31@yandex.ru
Researcher. Laboratory of genome analysis

Anna Aleksandrovna Kim

Vavilov Institute of General Genetics RAS

Email: annaalexa@ya.ru
Junior Researcher. Laboratory of genome analysis

Yekaterina Dmitriyevna Sanina

Vavilov Institute of General Genetics RAS

Email: lady.skeit@yandex.ru
Researcher. Laboratory of genome analysis

Vyacheslav Ivanovich Shirmanov

Peoples' Friendship University of Russia

Email: 777doktor@bk.ru
Lecturer of Tuberculosis Department

Vladimir Anatolyevich Koshechkin

Peoples' Friendship University of Russia

Email: asept@starnet.ru
Doct. Med. Sci., prof. The head of Tuberculosis Department

Oleg Pavlovich Balanovskiy

Vavilov Institute of General Genetics RAS

Email: balanovsky@inbox.ru
Doct Sci (Biol), Head of Laboratory of Genome

Nikolay Kazimirovich Yankovskiy

Vavilov Institute of General Genetics RAS

Email: yankovsky@vigg.ru
Doct Sci (Biol.), Prof. The head of lab. of genome analysis. Director of Vavilov Institute of General Genetics RAS

Svetlana Aleksandrovna Borinskaya

Vavilov Institute of General Genetics RAS

Email: borinskaya@vigg.ru
PhD., Doct Sci (Biol), leading scientist. Lab of genome analysis

References

  1. Степанов В. А., Балановский О. П., Мельников А. В. с соавт. 2011. Характеристика популяций Российской Федерации по панели пятнадцати локусов, используемых для ДНК-идентификации и в судебно-медицинской экспертизе. Acta Naturаe. Т. 3. № 2 (9): С. 59-71.
  2. Научная электронная библиотека elibrary.ru. Доступ 25.10.2013. URL: www.elibrary.ru.
  3. Albani D., Vittori A., Batelli S. et al., (2009) Serotonin transporter gene polymorphic element 5-HTTLPR increases the risk of sporadic Parkinson's disease in Italy. Eur Neurol. V. 62(2): P. 120-123.
  4. Al-Eitan L. N., Jaradat S. A., Qin W. et al., 2012. Characterization of serotonin transporter gene (SLC6A4) polymorphisms and its association with drug dependence in a Jordanian Arab population. Toxicol Ind Health. (Published online before print).
  5. ALFRED (Allele Frequency Database). Cited 25.10.2013. URL: http://alfred.med.yale.edu/alfred/.
  6. Baganz N. L., Blakely R. D. (2013) A dialogue between the immune system and brain, spoken in the language of serotonin. ACS Chem Neurosci. V. 4(1): P. 48-63.
  7. Bisso-Machado R., Ramallo V., Tarazona-Santos E. et al. (2013) 5-HTTLPR genetic diversity and mode of subsistence in Native Americans. Am J Phys Anthropol. V. 151(3): P. 492-494.
  8. Bonvicini C., Minelli A., Scassellati C. et al. (2010) Serotonin transporter gene polymorphisms and treatment-resistant depression. Prog Neuropsychopharmacol Biol Psychiatry. V. 34 (6): P. 934-939.
  9. Butovskaya M. L., Vasilyev V. A., Lazebny O. E. et al. (2012) Aggression, Digit Ratio, and Variation in the Androgen Receptor, Serotonin Transporter, and Dopamine D4 Receptor Genes in African Foragers: The Hadza. Behav. Genet. V. 42(4): P. 647-662.
  10. Caspi A., Sugden K., Moffitt T. E. et al. (2003) Influence of life stress on depression: moderation by a polymorphism in the 5-HTT gene.//Science. V. 301: P. 386-389.
  11. Caspi A., Hariri A. R., Holmes A. et al. (2010) Genetic sensitivity to the environment: the case of the serotonin transporter gene and its implications for studying complex diseases and traits. Am J Psychiatry. V. 167(5): P. 509-527.
  12. Cervilla J. A., Rivera M., Molina E. et al. (2006) PREDICT Study Core Group. The 5-HTTLPR s/s genotype at the serotonin transporter gene (SLC6A4) increases the risk for depression in a large cohort of priy care attendees. P. the PREDICT-gene study. Am J Med Genet B Neuropsychiatr Genet. V. 141B(8): P. 912-917.
  13. Chabane N., Millet B., Delorme R. et al. (2004) Lack of evidence for association between serotonin transporter gene (5-HTTLPR) and obsessive-compulsive disorder by case control and family association study in humans. Neurosci Lett. V. 363(2): P. 154-156.
  14. Chiao J. Y., Blizinsky K. D. (2010) Culture-gene coevolution of individualism-collectivism and the serotonin transporter gene. Proc Biol Sci. V. 277(1681): P. 529-537.
  15. Chong S. A., Lee W. L., Tan C. H.et al. (2000) Attempted suicide and polymorphism of the serotonin transporter gene in Chinese patients with schizophrenia. Psychiatry Res. V. 97(2-3): P. 101-106.
  16. Database for autosomal short tandem repeats. Cited 25.10.2013. URL: http://allstr.de.
  17. De Neve J. E., Christakis N. A., Fowler J. H., Frey B. S. (2012) Genes, Economics, and Happiness. J Neurosci Psychol Econ. V. 5(4): P. 193-211.
  18. Eisenberg D. T., Hayes M. G. (2011) Testing the null hypothesis: comments on “Culture-gene coevolution of individualism-collectivism and the serotonin transporter gene”. Proceedings of the Royal Society B: Biological Sciences. 278(1704): P. 329-332.
  19. Elston R. C., Forthofer R. (1977) Testing for Hardy-Weinberg equilibrium in small samples. Biometrics. V. 33: P. 536-542.
  20. Esau L., Kaur M., Adonis L., Arieff Z. (2008) The 5-HTTLPR polymorphism in South African healthy populations: a global comparison. J Neural Transm. V. 115(5): P. 755-760.
  21. Farjadian S., Fakhraei B., Moeini M. et al. (2013) Serotonin transporter gene polymorphisms in Southwestern Iranian patients with irritable bowel syndrome. Arab J Gastroenterol. V. 14(2): P. 59-62.
  22. Grabe H. J., Spitzer C., Schwahn C. et al. (2009) Serotonin transporter gene (SLC6A4) promoter polymorphisms and the susceptibility to posttraumatic stress disorder in the general population. Am J Psychiatry. V. 166(8): P. 926-933.
  23. Guhathakurta S., Ghosh S., Sinha S. et al. (2006) Serotonin transporter promoter variants. P. Analysis in Indian autistic and control population. Brain Res. V. 1092(1): P. 28-35.
  24. Gustavsson J. P., Nöthen M. M., Jönsson E. G. et al. (1999) No association between serotonin transporter gene polymorphisms and personality traits. Am J Med Genet. V. 88(4): P. 430-436.
  25. Hancock A. M., Witonsky D. B., Ehler E. et al. (2010) Colloquium paper: human adaptations to diet, subsistence, and ecoregion are due to subtle shifts in allele frequency. Proc. Natl. Acad. Sci. USA. V. 107(2): P. 8924-3890.
  26. Heils A., Teufel A., Petri S., Stober G. Et al. (1996) Allelic variation of human serotonin transporter gene expression. J. Neurochem. V. 66: P. 2621-2624.
  27. Hofstede G. (2001) Culture’s consequences: comparing values, behaviors, institutions and organizations across nations. (2nd ed.). Thousand Oaks, CA: SAGE Publications.
  28. Jacob C. P., Strobel A., Hohenberger K. et al. (2004) Association between allelic variation of serotonin transporter function and neuroticism in anxious cluster C personality disorders. Am J Psychiatry. V. 161(3): P. 569-572.
  29. Karg K., Burmeister M., Shedden K., Sen S. 2011. The serotonin transporter promoter variant (5-HTTLPR), stress, and depression meta-analysis revisited: evidence of genetic moderation. Arch Gen Psychiatry. V. 68(5): P. 444-454.
  30. Katsuragi S., Kunugi H., Sano A. et al. (1999) Association between serotonin transporter gene polymorphism and anxiety-related traits. Biol Psychiatry. V. 45: P. 368-370.
  31. Kenna G. A., Roder-Hanna N., Leggio L. et al. (2012) Association of the 5-HTT gene-linked promoter region (5-HTTLPR) polymorphism with psychiatric disorders: review of psychopathology and pharmacotherapy. Pharmgenomics Pers Med. V. 5: P. 19-35.
  32. Kim S. J., Kang J. I., Namkoong K., Song D. H. (2011)The effects of serotonin transporter promoter and monoamine oxidase A gene polymorphisms on trait emotional intelligence. Neuropsychobiology. V. 64(4): P. 224-230.
  33. Koenen K. C., Aiello A. E., Bakshis E. et al. (2009) Modification of the Association Between Serotonin Transporter Genotype and Risk of Posttraumatic Stress Disorder in Adults by County-Level Social Environment. American Journal of Epidemiology. V. 169(6): P. 704-711.
  34. Landaas E. T., Johansson S., Jacobsen K. K. et al. (2010) An international multicenter association study of the serotonin transporter gene in persistent ADHD. Genes Brain Behav. V. 9(5): P. 449-458.
  35. Lazary J., Lazary A., Gonda X. et al. (2008) New Evidence for the Association of the Serotonin Transporter Gene (SLC6A4) Haplotypes, Threatening Life Events, and Depressive Phenotype. Biol Psychiatry. V. 64: P. 498-504.
  36. Lesch K.-P., Bengel D., Heils A. et al. (1996) Association of anxiety-related traits with a polymorphism in the serotonin transporter gene regulatory region. Science. V. 274: P. 1527-1530.
  37. Li J., Wang Y., Zhou R. et al., 2007 Association between polymorphisms in serotonin transporter gene and attention deficit hyperactivity disorder in Chinese Han subjects. Am J Med Genet B Neuropsychiatr Genet. V. 144B(1). P. 14-19.
  38. Long H., Liu B., Hou B. et al. (2013) The long rather than the short allele of 5-HTTLPR predisposes Han Chinese to anxiety and reduced connectivity between prefrontal cortex and amygdala. Neurosci Bull. V. 29(1): P. 4-15.
  39. Lotrich F. E., Pollock B. G., Ferrell R. E. (2003) Serotonin transporter promoter polymorphism in African Americans: allele frequencies and implications for treatment. Am J Pharmacogenomics. V. 3(2): P.145-147.
  40. Manor I., Eisenberg J., Tyano S. et al. Family-based association study of the serotonin transporter promoter region polymorphism (5-HTTLPR) in attention deficit hyperactivity disorder. Am J Med Genet. V. 105(1). P. 91-95.
  41. Maron E., Tammiste A., Kallassalu K. et al. (2009) Serotonin transporter promoter region polymorphisms do not influence treatment response to escitalopram in patients with major depression. Eur Neuropsychopharmacol. V. 19(6): P. 451-456.
  42. Martaskova D., Slachtová L., Kemlink D. et al. (2009) Polymorphisms in serotonin-related genes in anorexia nervosa. The first study in Czech population and metaanalyses with previously performed studies. Folia Biologica. V. 55: P. 192-197.
  43. Matsunaga М., Isowa T., Yamakawa K., Ohira H. (2013) Association between the serotonin transporter polymorphism (5HTTLPR) and subjective happiness level in Japanese adults. Psychology of Well-Being: Theory, Research and Practice V. 3: P. 5.
  44. Middeldorp C. M., de Geus E. J., Beem A. L.et al. (2007) Family based association analyses between the serotonin transporter gene polymorphism (5-HTTLPR) and neuroticism, anxiety and depression. Behav Genet. V. 37(2): P. 294-301.
  45. Miu A. C., Crişan L. G., Chiş A. et al. (2012) Somatic markers mediate the effect of serotonin transporter gene polymorphisms on Iowa Gambling Task. Genes, Brains, Behavior. V. 11(4): P. 398-403
  46. Mohamed Saini S., Nik Jaafar N. R., Sidi H. et al. (2013) Serotonin Transporter Gene Polymorphism and its association with bipolar disorder across different ethnic groups in Malaysia. Compr Psychiatry. pii: S0010-440X (12)00261-1.
  47. Munafò M. R., Durrant C., Lewis G., Flint J. (2009) Gene X environment interactions at the serotonin transporter locus. Biol Psychiatry. V. 65(3): P. 211-219.
  48. Murakami F., Shimomura T., Kotani K. et al. (1999) Anxiety traits associated with a polymorphism in the serotonin transporter gene regulatory region in the Japanese. J Hum Genet. V. 44(1): P. 15-17.
  49. Murdoch J. D., Speed W. C., Pakstis A. J. et al. (2013) Worldwide population variation and haplotype analysis at the serotonin transporter gene SLC6A4 and implications for association studies. Biol Psychiatry. V. 74(12): P. 879-889.
  50. Nasserddine S., Hamzi K., Diakite N. et al. (2012) Distribution of 5-HTTLPR Serotonin Transporter Polymorphism in Moroccan Population. Int J LifeSci & Pharm Res. Vol. 1: P. 278-281.
  51. Noskova T., Pivac N., Nedic G. et al. (2008) Ethnic differences in the serotonin transporter polymorphism (5-HTTLPR) in several European populations. Prog Neuropsychopharmacol Biol Psychiatry. V. 32(7). P. 1735-1739.
  52. Noskova T., Pivac N., Nedic G., Kazantseva A. (2008) Ethnic differences in the serotonin transporter polymorphism (5-HTTLPR) in several European populations. Prog. Neuro-Psychopharmacol. Biol. Psychiatry. V. 32: P. 1735-1739.
  53. Novembre J., Johnson T., Bryc K. et al. (2008) Genes mirror geography within Europe. Nature V. 456(7218): P. 98-101.
  54. PubMed. Cited 25.10.2013. URL: http://www.ncbi.nlm.nih.gov/pubmed/.
  55. Pungercic G., Videtic A., Pestotnik A. et al. (2006) Serotonin transporter gene promoter (5-HTTLPR) and intron 2 (VNTR) polymorphisms: a study on Slovenian population of suicide victims. Psychiatr Genet. V. 16(5): P. 187-91.
  56. Ramamoorthy S., Bauman A. L., Moore K. R. et al. (1993) Antidepressant- and cocaine-sensitive human serotonin transporter: molecular cloning, expression, and chromosomal localization. Proc. Nat. Acad. Sci. V. 90(6): P. 2542-2546.
  57. Risch N., Herrell R., Lehner T. et al. (2009) Interaction between the serotonin transporter gene (5-HTTLPR), stressful life events, and risk of depression: a meta-analysis. JAMA. V. 301(23): P. 2462-2471.
  58. Rosenberg N. A., Mahajan S., Ramachandran S. et al. (2005) Clines, clusters, and the effect of study design on the inference of human population structure. PLoS Genet. V. 1: P. e70.
  59. Saiz P. A., Garcia-Portilla M. P., Arango C. (2008) Association study between obsessive-compulsive disorder and serotonergic candidate genes. Prog Neuropsychopharmacol Biol Psychiatry. V. 32(3): P. 765-770.
  60. Sanders-Bush E., Mayer S. E. (2006) 5-Hydroxytryptamine (serotonin) receptor agonists and antagonists. In: Brunton L. L., Lazo J. S., Parker K. L., editors. The Pharmacological Basis of Therapeutics. Goodman &, Gilman's McGaw-Hill; P. 297-315.
  61. Schild A. H., Nader I. W., Pietschnig J., Voracek M. (2014) Ethnicity Moderates the Association Between 5-HTTLPR and National Suicide Rates. Arch Suicide Res. V.18 (1): P. 1-13.
  62. Shen Y., Li H., Gu N. et al. (2004) Relationship between suicidal behavior of psychotic inpatients and serotonin transporter gene in Han Chinese. Neurosci Lett. V. 372(1-2): P. 94-98.
  63. Sieminska A., Buczkowski K., Jassem E., Tkacz E. (2008) Lack of association between serotonin transporter gene polymorphism 5-HTTLPR and smoking among Polish population: a case-control study. BMC Med Genet. V. 9: P. 76.
  64. Szekely A., Ronai Z., Nemoda Z. et al. (2004) Human personality dimensions of persistence and harm avoidance associated with DRD4 and 5-HTTLPR polymorphisms. Am J Med Genet. Part B. V. 126B(1): P. 106-110.
  65. Tabagh R., Andres C. R., Védrine S. et. (2010) Study of the serotonin transporter (SLC6A4) and BDNF genes in French patients with non syndromic mental deficiency. BMC Med Genet. V. 11: P. 30.
  66. Tencomnao T., Sritharathikhunb T., Suttiratc S. (2010) Influence of demographic factors and serotonin transporter-linked polymorphic region (5-HTTLPR) variants on major depression in a northeastern Thai population. Asian Biomedicine. V. 4: P. 893-899.
  67. The Distribution of the Human DNA-PCR Polymorphisms. Cited 10.01.2014. URL: http://www.uniduesseldorf.de/WWW/MedFak/Serology/database.html.
  68. The Hofstede Centre. Cited 12.02.2014. URL: http://geert-hofstede.com/.
  69. Tibrewal P., Ku H. B., Shubha G. N. et al. (2010) Association of serotonin transporter gene polymorphisms with obsessive-compulsive disorder (OCD) in a south Indian population. Indian J Med Res. V. 132: P. 690-695.
  70. Tsai S. J., Hong C. J., Cheng C. Y. (2002) Serotonin transporter genetic polymorphisms and harm avoidance in the Chinese. Psychiatr Genet. V. 12: P. 165-168.
  71. Way B. M., Lieberman M. D. (2010) Is there a genetic contribution to cultural differences? Collectivism, individualism and genetic markers of social sensitivity. Soc Cogn Affect Neurosci. V. 5(2-3): P. 203-211.
  72. Wichers M., Kenis G., Jacobs N. (2008) The BDNF Val (66)Met x 5-HTTLPR x child adversity interaction and depressive symptoms: An attempt at replication. Am J Med Genett Part B. 147B. P. 120-123.
  73. Willeit M, Praschak-Rieder N, Neumeister A. et al. (2003) A polymorphism (5-HTTLPR) in the serotonin transporter promoter gene is associated with DSM-IV depression subtypes in seasonal affective disorder. Mol Psychiatry. V. 8(11): P. 942-946.
  74. Willis-Owen S. A., Turri M. G., Munafò M. R. et al. (2005) Surtees P. G., Wainwright N. W., Brixey R. D., Flint J. The serotonin transporter length polymorphism, neuroticism, and depression: a comprehensive assessment of association. Biol Psychiatry. V. 58(6): P. 451-456.

Statistics

Views

Abstract - 966

PDF (Russian) - 355

Cited-By


Article Metrics

Metrics Loading ...

PlumX

Dimensions


Copyright (c) 2014 Gureyev A.S., Kim A.A., Sanina Y.D., Shirmanov V.I., Koshechkin V.A., Balanovskiy O.P., Yankovskiy N.K., Borinskaya S.A.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies