Characterization and identification of naturally transgenic species Linaria vulgaris pathogenic mycromycetes

Cover Page

Abstract


In nature there are species containing homologs of T-DNA genes of agrobacteria (сT-DNA) in their genomes. Such plants are called naturally transgenic ones. Interaction with the microbiota is one of the possible functions of cT-DNA, discussed in the literature. Linaria plants are the most suitable for the investigation of the probable ecological role of T-DNA, since they widely spread. The first stage in the evaluation of plant-microbial interactions involving these plants is the description of isolates with contrasting virulence for toadflax. The search and DNA-barcoding of such isolates of Phoma-like fungi was the goal of this work. 14 strains isolated from the plants of the families Plantaginaceae and Scrophullariaceae were analyzed. The of multilocus analysis included amplification and sequencing of internal transcribed spacers, a large subunit of RNA, a tubulin gene. Based on molecular data, 9 strains were assigned to the species Boeremia exigua, which has a wide range of habitats and a wide specialization. Strains of this species were virulent against L. vulgaris, but differed in aggressiveness with respect to this plant. Thus, a collection of strains was characterized, which can later be used for a more detailed study of the immune response of the naturally-transgenic L. vulgaris plant in response to inoculation with the B. exigua phytopathogen. As a result of the work, we identified the narrow host range fungi Heterophoma novae-verbascicola, and broad host range pathogens Plectosphaerella cucumerina, Phoma herbarum and Trichothecium roseum. Among them, only P. cucumerina was a weak pathogen of L. vulgaris. These results confirm the early data on the depleted mycobiota of L. vulgaris.


Введение

В настоящий момент известно три рода растений Nicotiana, Ipomoea и Linaria, в пределах которых выявлены представители, содержащие в геноме участки ДНК, гомологичной Т-ДНК агробактерий, как результат горизонтального переноса генов. Многочисленные исследования показывают, что у природно-трансгенных растений, относящихся к родам Nicotiana и Ipomoea, экспрессируются гены Т-ДНК [1, 2]. Недавно была продемонстрирована экспрессия гена rolC и у льнянок [3]. Это свидетельствует о том, что клТ-ДНК функ циональна. На каллусных культурах показано влияние онкогенов rolA, rolB и rolC Agrobacterium rhizogenes на повышение стресс-устойчивости, в том числе за счет повышения уровня вторичных метаболитов, образования активных форм кислорода, экспрессии PR-белков и изменения путей метаболизма сахарозы [4–7]. Ряд этих механизмов растения реализуют при защите от патогенных микромицетов, но на данный момент не изучена устойчивость к болезням у видов, экспрессирующих гены rolA, rolB и rolC. Из природно-трансгенных растений только льнянки широко распространены в дикой природе [8]. Поэтому они могут служить моделью для изучения возможной экологической роли горизонтально перенесенных в их геномы последовательностей ДНК. Для этого требуется проведение большой подготовительной работы в разных направлениях, в том числе необходимы детальные исследования возможных межвидовых взаимодействий с участием льнянок. Частным случаем таких взаимодействий являются отношения растение — фитопатоген. На начальных этапах данного исследования необходимо выявить наиболее распространенных и агрессивных в отношении льнянок патогенов. Обедненный состав микобиоты природно-трансгенного вида Linaria vulgaris, преимущественно состоящий из фомоидного микромицета Boeremia exigua (Desm.) Aveskamp, Gruyter & Verkley (=Phoma exigua var. exigua), а также представителей родов Ramularia и Phomopsis может служить косвенным доказательством возможной роли rolC в регуляции устойчивости к патогенам [9]. Идентификация фомоидных патогенов затруднена из-за схожести морфолого-культуральных признаков, так как у представителей близкородственных секций размер конидий, характер роста на агаре и другие признаки могут быть неразличимы [10]. В то же время даже у близкородственных видов паразито-хозяинные отношения имеют свои особенности как со стороны микромицета, так и со стороны ответа растения. Поэтому точная видоидентификация патогенов природно-трансгенных льнянок представляет особый интерес. Эта работа важна для обнаружения и паспортизации изолятов, характеризующихся контрастными проявлениями вирулентности, так как это позволит в дальнейшем создать коллекцию для определения особенности иммунного ответа трансгенных растений при заражении. Ранее было показано, что патогенами льнянок являются преимущественно фомоидные микромицеты [9]. Филогенетическая специализация этих патогенов различна. Есть как узкоспециализированные виды, приуроченные к растениям, лежащим в пределах одного семейства, так и виды, способные заражать представителей более 10 семейств [10]. Для расширения коллекции фитопатогенных микромицетов с различной агрессивностью в отношении льнянок был проведен дополнительный скрининг среди фитопатогенов семейства Plantaginaceae, а также родственного ему семейства Scrophullariaceae (куда ранее относили льнянку). Поэтому в данную работу вошел материал, собранный не только на растениях L. vulgaris, но и на видах Plantago major, Veronica sp. (Plantaginaceae), Verbascum sp, Verbascum thapsus (Scrophullariaceae). Для видоидентификации фомоидных грибов на практике широко используются молекулярные методы, в частности мультилокусный анализ по участкам внутренних транскрибируемых спейсеров, большой субъединицы РНК, гена тубулина [11, 12]. Таким образом, целью данной работы стала уточняющая идентификация видов, встречающихся на растениях семейств Plantaginaceae и Scrophullariaceae, оценка их вирулентности в отношении природно-трансгенного растения L. vulgaris, создание коллекции штаммов для изучения влияния генов клТ-ДНК на взаимодействие растений льнянки с фомоидными микромицетами.

Материал и методы

В работе использовали штаммы из коллекции лабораторий микологии и фитопатологии и токсикологии и биотехнологии ФГБНУ ВИЗР, хранящиеся при 5 °C в пробирках на скошенном картофельно-глюкозном агаре (КГА) (табл. 1).

 

Таблица 1. Штаммы микромицетов, использованных в работе

Table 1. Strains of micromycetes used in the researchwork

Маркировка

Семейство

Вид

Место

1

12_18

Scrophulariaceae

Verbascum sp.

Липецк

2

17_39

Plantaginaceae

Plantago major

Лен. обл., Гатчинский р-н

3

17_82

Plantaginaceae

Plantago major

Лен. обл., Ломоносовский р-н, п. Горелово

4

17_87

Plantaginaceae

Plantago major

Лен. обл., Ломоносовский р-н, п. Горелово

5

32_11

Plantaginaceae

Plantago major

Лен. обл., Кировский р-н, п. Назия

6

32_13

Plantaginaceae

Plantago major

Московская обл., Голицыно

7

32_25

Plantaginaceae

Plantago major

Ростовская обл., Славский р-н

8

32_36

Scrophulariaceae

Verbascum nigrum

Ставрополь

9

32_150

Scrophulariaceae

Verbascum thapsus

Адыгея, Майкопский район, п. Подгорный

10

32_151

Plantaginaceae

Veronica sp.

Иркутская обл.

11

32_226

Plantaginaceae

Plantago major

Сев. Осетия, Даргавс

12

Ph 6

Plantaginaceae

Linaria vulgaris

Тульская обл.

13

263_Ph6

Plantaginaceae

Linaria vulgaris

Тульская обл.

14

263_Ph6_2

Plantaginaceae

Linaria vulgaris

Тульская обл.

 

Патогенность штаммов оценивали методом заражения листовых дисков [9].

Для получения препарата ДНК фрагменты мицелия гриба объемом около 10 мкл помещали в микроцентрифужную пробирку, содержащую 500 мкл буфера ТЕ. Далее пробирку инкубировали в течение 10 минут на кипящей водяной бане, затем центрифугировали 3 минуты при 8000 g, далее 1 мкл надосадочной жидкости брали в реакционную смесь для проведения ПЦР.

ПЦР проводили в объеме 20 мкл. В состав смеси входили: DreamTaq™ Green Master Mix (2X) (ThermoScientific), по 5 пикомолей каждого праймера и 1 мкл препарата ДНК. Последователь ности праймеров представлены в таблице 2. Праймеры синтезированы компанией «Евроген».

 

Таблица 2. Праймеры, использованные в работе

Table 2. Primers, used in the researchwork

Название

Последовательность 5’–3’

Ссылка

1

ITS4

TCCTCCGCTTATTGATATGC

14

2

ITS5

GGAAGTAAAAGTCGTAACAAG

3

LROR

GTACCCGCTGAACTTAAGC

15

4

LR5

TCCTGAGGGAAACTTCG

16

5

T1

AACATGCGTGAGATTGTAAGT

17

6

T2

TAGTGACCCTTGGCCCAGTTG

7

Btub2Fd

GTBCACCTYCARACCGGYCARTG

18

8

Btub4Rd

CCRGAYTGRCCRAARACRAAGTTGTC

 

Анализ нуклеотидных последовательностей выполняли при помощи программы MEGA 7.0.21 [13]. Референсные последовательности представлены в таб лице 3.

Результаты и обсуждение

Молекулярно-генетический анализ 14 штаммов, 11 из которых были выделены в чистую культуру из некротических пятен на листьях растений семейства Plantaginaceae и 3 из семейства Scrophulariaceae, показал, что 9 штаммов относятся к виду B. exigua (табл. 4). В описании этого вида, данном Van der Aa et al. [19], говорится, что в Евразии вид B. exigua имеет обширный ареал обитания [20] и широкую специализацию, то есть один и тот же штамм может поражать растения нескольких семейств [10, 19]. Любопытно, что среди проанализированных штаммов B. exigua восемь исходно были выделены из растений семейства Plantaginaceae. Также в пределах этого семейства были найдены штаммы Phoma herbarum Westend. и Trichothecium roseum (Pers.) (см. табл. 4).

 

Таблица 3. Референсные последовательности

Table 3. Reference sequences

Номер GenBank

Растение-хозяин

Семейство

Место обнаружения

1

LT158235.1

Glycine max

Fabaceae

Китай, Цзилинь

2

KT309446.1

Cytisus scoparius

Fabaceae

Новая Зеландия

3

KT309407.1

Cynara scolymus

Asteraceae

Новая Зеландия

4

KT309519.1

Cynara scolymus

Asteraceae

Новая Зеландия

5

GU237495.1

Cichorium intybus

Asteraceae

Нидерланды

6

KT309512.1

Fragaria ananassa

Rosaceae

Новая Зеландия

7

КТ309489.1

Linum usitatissimum

Linaceae

Венгрия

8

GU237499.1

Linum usitatissimum

Linaceae

Нидерланды

9

GU237500.1

Linum usitatissimum

Linaceae

Нидерланды

10

KT389784.1

Nicotiana tabacum

Solanaceae

Китай, Пекин

11

KT309500.1

Lycopersicon esculentum

Solanaceae

Новая Зеландия

12

KR653202.1

Ipomoea batatas

Solanaceae

Китай, Ханчжоу

13

KR653203.1

Ipomoea batatas

Solanaceae

Китай, Ханчжоу

14

KR653201.1

Ipomoea batatas

Solanaceae

Китай, Ханчжоу

15

KT309617.1

Cyphomandra betacea

Solanaceae

Новая Зеландия

16

FJ427112.1

Solanum tuberosum

Solanaceae

Нидерланды

17

KT309470.1

Actinidia chinensis

Actinidiaceae

Новая Зеландия

18

GU237493.1

Forsythia sp.

Oleaceae

Нидерланды

19

GU237494.1

Forsythia sp.

Oleaceae

Нидерланды

20

GU237498.1

Syringa vulgaris

Oleaceae

Нидерланды

21

GU237503.1

Syringa vulgaris

Oleaceae

Нидерланды

22

GU237504.1

Coffea arabica

Rubiaceae

Бразилия

23

GU237505.1

Coffea arabica

Rubiaceae

Камерун

 

Патогены, выявленные на растениях семейства Scrophulariaceae, относились к различным видам: Heterophoma novae-verbascicola (Aveskamp, Gruyter & Verkley) Q. Chen & L. Cai, Plectosphaerella cucumerina (Lindf.) W. Gams и B. exigua. Из них патоген H. novae-verbascicolaимеет узкую специализацию и приурочен к семейству Scrophulariaceae. Фитопатогены P. cucumerina, P. herbarum и T. roseum имеют широкую специализацию, встречаются на растениях Lamiaceae, Apiaceae, Solanaceae, Asteraceae и т. д. Интересно, что патоген P. cucumerina (штамм WST1, KU640393) был обнаружен на заразихе, среди вторичных метаболитов которой есть антиррид [20]. Антиррид — редко встречающийся иридоидный гликозид с фунгицидной активностью, который является мажорным компонентом конститутивной защиты льнянок [21]. Патоген P. herbarum хорошо изучен, встречается в различных географических точках как на однодольных, так и на двудольных растениях. В базе NCBI имеется полногеномный сиквенс P. herbarum штамма JCM 15942 (GenBank: BCGR00000000.1).

Оценка вирулентности анализируемых штаммов показала, что среди изученных штаммов наиболее агрессивные в отношении льнянок формы найдены в пределах вида B. exigua. Кроме штаммов из микобиоты льнянок, L. vulgaris заражал штамм B. exigua 32_36, выделенный из Verbascum nigrum (Scrophulariaceae). Менее агрессивными, но все же вызывающими достоверные некротические пятна на отрезках листьев L. vulgaris на 3-и сутки после заражения были штаммы B. exigua 32_226 и 32_11, выделенные из Plantago major (Plantaginaceae) (см. табл. 4). Крайне слабую агрессивность в отношении L. vulgaris проявляли выделенные из того же растения-хозяина штаммы B. exigua 17_82, 17_87, 32_11, 32_13. Среди других видов можно выделить штамм P. cucumerina 32_150, вызвавший слабое заражение льнянки.

 

Таблица 4. Суммарные данные по видоидентификации и вирулентности штаммов

Table 4. Species identification and virulence

Штамм

Номер последовательности маркера

Вид

Вирулентность

ITS

LSU

beta-tubulin

1

12_18

KY234213.1

KY234154

MG029466

Heterophoma novae-verbascicola

– – –

2

17_39

MF599110

MF599105

MG029470

Boeremia exigua

+ – –

3

17_82

KY234205

KY234146

KY273917

Boeremia exigua

+ – –

4

17_87

KY234206

KY234147

KY273918

Boeremia exigua

+ – –

5

32_11

KY234207

KY234148

KY273919

Boeremia exigua

+ – –

6

32_13

KY234209

KY234150

MG029464

Boeremia exigua

+ – –

7

32_25

MF599106

MF599101

MG029469

Phoma herbarum

– – –

8

32_36

MF599107

MF599102

MG029468

Boeremia exigua

+ + –

9

32_150

KY234211

KY234152

MG029465

Plectosphaerella cucumerina

+ – –

10

32_151

KY234208

KY234149

KY273920

Phoma sp.

– – –

11

32_226

KY234212

KY234153

KY273922

Boeremia exigua

+ + –

12

263 Ph6

MF599109

 MF599104

MG029467

Boeremia exigua

+ + +

13

263 Ph6 2

MF599108

MF599103

MG029471

Boeremia exigua

+ + +

14

Ph6

KY234210

KY234151

KY273921

Trichothecium roseum

– – –

Примечание: + + + — площадь некрозов отрезков листьев 75–100 %; + + – — площадь некрозов 45–75 %; + – –  — площадь некрозов 20–45 %; – – – — площадь некрозов менее 20 %

 

Среди изученных фрагментов таксономически значимых районов ДНК наиболее вариабельным оказался фрагмент гена tub2. На его основе было построено филогенетическое древо, отражающее родство изолятов B. exigua (рис. 1). При его построении были использованы также последовательности данного маркера из базы NCBI (см. табл. 3). Они относятся к изолятам, выделенным с разных растений-хозяев и из различных географических точек. Хотя для фомоидных микромицетов принято считать, что взаимосвязи между растением-хозяином и родством его заражающих патогенов не существует [25], на нашем древе обнаружены некоторые моменты, которые трудно считать случайными. Так, несмотря на то, что изоляты, выделенные с Plantaginaceae, распределены по всему древу, тем не менее есть группа наиболее вирулентных в отношении льнянки патогенов, которая образует общую ветвь на древе. Аналогично обстоит дело с изолятами, выделенными с батата. То есть, несмотря на широкий спектр хозяев, можно говорить о склонности отдельных рас заражать преимущественно родственные виды из одного или близких семейств. При поиске таких рас имеет смысл обращать внимание на несколько факторов, по крайней мере таких, как растение-хозяин и география сбора. Хотя для более ясной картины требуются дополнительные исследования.

 

Рис. 1. Филогенетическое древо изолятов Boeremia exigua с указанием растений-хозяев. Древо построено с применением метода максимального правдоподобия. Консенсусное древо построено на основе 500 реплик бутстрепа. Начальное древо для эвристического поиска было получено автоматически, путем применения алгоритмов Neighbor-Join и BioNJ к матрице попарных расстояний, оцененных с использованием модели JTT, а затем выбора топологии с более высоким значением логарифма правдоподобия [22–24]

 

Вирулентные в отношении льнянок штаммы B. exigua были выделены из растений, чей конститутивный иммунитет против болезней основан на синтезе таких вторичных метаболитов, как иридоидные гликозиды и флавоноиды. Одна из возможных функций гена rolCзаключается в увеличении синтеза мажорных вторичных метаболитов, что в свою очередь могло дать преимущество предковым формам, в чьих геномах закреплялась и передавалась по наследству Т-ДНК, гомологичная агробактериальной [21]. Выявленная, благодаря проведенному исследованию, система L. vulgaris/B. exigua предоставляет уникальную возможность для изучения особенностей защиты таких природно-трансгенных растений. Хорошо известно, что паразито-хозяинные отношения претерпевают ряд изменений в процессе эволюции. Превалирование среди патогенов льнянок B. exigua указывает на то, что патогенез у природно-трансгенных растений может иметь ряд индивидуальных особенностей. На наш взгляд, в дальнейшем необходимо более тонкое изучение патогенеза, в частности, инокуляция целых растений L. vulgaris различающимися по агрессивности штаммами B. exigua и анализ развития болезни на организменном и клеточном уровнях. Кроме того, целесообразно оценить внутривидовую изменчивость штаммов B. exigua при помощи микросателлитных маркеров.

Таким образом, нами охарактеризовано 14 изолятов микромицетов. Больше всего вирулентных к льнянке образцов выявлено среди представителей вида B. exigua. На основе изолятов этого вида создана коллекция, которая в дальнейшем может быть использована для более детального изучения иммунного ответа природно-трансгенного растения L. vulgaris в ответ на инокуляцию данным фитопатогеном. Итогом выполнения работы стала идентификация узкоспециализированного вида H. novae-verbascicola и широко специализированных видов P. cucumerinа, P. herbarum и T. roseum, среди которых только P. cucumerina был слабым патогеном льнянок. Результаты подтверждают раннее полученные данные об обедненной микобиоте L. vulgaris.

 

Работа выполнена при финансовой поддержке РНФ, грант № 16-16-10010. Авторы благодарят РЦ СПбГУ «Развитие молекулярных и клеточных технологий» и лично Е.Ю. Городилову и А.Э. Машарского за содействие в проведении секвенирования ДНК.

Sofia V. Sokornova

All-Russia Institute of Plant Protection

Author for correspondence.
Email: mymryk@gmail.com
SPIN-code: 3223-0513

Russian Federation, Pushkin, Saint Petersburg

Senior Researcher

Elena L. Gasich

All-Russia Institute of Plant Protection

Email: elena_gasich@mail.ru
SPIN-code: 1101-5323

Russian Federation, Pushkin, Saint Petersburg

Senior Researcher

Victoria D. Bemova

Saint Petersburg State University

Email: viktoria.bemova@yandex.ru

Russian Federation, Saint Petersburg

Master Student

Tatiana V. Matveeva

Saint Petersburg State University

Email: radishlet@gmail.com
SPIN-code: 3877-6598

Russian Federation, Saint Petersburg

Professor

  1. Kyndt T, Quispe D, Zhai H, et al. The genome of cultivated sweet potato contains Agrobacterium T-DNAs with expressed genes: An example of a naturally transgenic food crop. Proc Natl Acad Sci USA. 2015;112(18): 5844-5849. doi: 10.1073/pnas.1419685112.
  2. Chen K, Otten L. Natural Agrobacterium Transformants: Recent Results and Some Theoretical Considerations. Front Plant Sci. 2017;8:1600. doi: 10.3389/fpls.2017.01600.
  3. Матвееева Т.В., Богомаз О.Д., Голованова Л.А., и др. Гомологи гена rolC природно-трансгенных льнянок Linaria vulgaris и Linaria creticola экспрессируются in vitro // Вавиловский журнал генетики и селекции. 2018;22(2):273-278. [Mat veeva TV, Bogomaz OD, Golovanova LA et al. Homologs of the rolC gene of naturally transgenic toadflaxes Linaria vulgaris and Linaria creticola are expressed in vitro. Russian Journal of Genetics: Applied Research. 2018;22(2):273-278 (In Russ.)]. doi: 10.18699/VJ18.359.
  4. Bulgakov VP, Tchernoded GK, Mischenko NP, et al. Effect of salicylic acid, methyl jasmonate, ethephon and cantharidin on anthraquinone production by Rubia cordifolia callus cultures transformed with the rolB and rolC genes. J Biotechnol. 2002;97(3):213-221. doi: 10.1016/s0168-1656(02)00067-6.
  5. Гюнтер Е.А., Попейко О.В., Шкрыль Ю.Н., и др. Влияние агробактериальных генов rol на содержание, строение пектиновых веществ и активность гликаназ в культурах трансгенных клеток Rubia cordifolia // Прикладная биохимия и микробиология. – 2013. – Т. 49. – № 4. – С. 409–416. [Gunter EA, Popeyko OV, Shkryl YN, et al. Effect of the rol Genes from Agrobacterium rhizogenes on the Content and Structure of Pectic Substances and Glycanase Activity in Rubia cordifolia Transgenic Cell Cultures. Applied biochemistry and microbiology. 2013;49(4):409-416. (In Russ.)]. doi: 1134/S0003683813040066.
  6. Veremeichik GN, Shkryl YN, Bulgakov VP, et al. Molecular cloning and characterization of seven class III peroxidases induced by overexpression of the agrobacterial rolB gene in Rubia cordifolia transgenic callus cultures. Plant Cell Rep. 2012;31(6):1009-1019. doi: 10.1007/s00299-011-1219-3.
  7. Bulgakov VP, Shkryl YN, Veremeichik GN, et al. Recent advances in the understanding of Agrobacterium rhizogenes-derived genes and their effects on stress resistance and plant metabolism. Adv Biochem Eng Biotechnol. 2013;134:1-22. doi: 10.1007/10_2013_179.
  8. plantarium.ru [интернет]. Определитель растений on-line [доступ от 01.10.2017]. Доступ по ссылке http://www.plantarium.ru/. [Plantarium.ru [Internet]. Identification guide for plants [cited 2017 October 1]. Available from: http://www.plantarium.ru/. (In Russ.)]
  9. Сокорнова С.В., Гасич Е.Л., Матвеева Т.В., Афонин А.Н. Микромицеты растений рода Linaria, содержащих в геноме т-ДНК // Микология и фитопатология. – 2015. – Т. 49. – № 3. – С. 188–193. [Sokornova SV, Gasich EL, Matveeva TV, Afonin AN. Micromycetes of plants Linariacontaining DNA sequences of agrobacterial origin in their genomes. Mikol Fitopatol. 2015;49(3):188-193. (In Russ.)]
  10. Boerema GH, de Gruyter J, Noordeloos ME, Hamers MEC Phoma identification Manual: differentiation of Specific and Infra-specific Taxa in Culture. Wallingford: CABI Publishing; 2004.
  11. Aveskamp MM, de Guyter J, Crous PW. Biology and recent developments in the systematics of Phoma, a complex genus of major quarantine significance. Fungal Divers. 2008;31:1-18.
  12. Chen Q, Jiang JR, Zhang GZ, et al. Resolving the Phoma enigma. Stud Mycol. 2015;82:137-217. doi: 10.1016/j.simyco.2015.10.003.
  13. Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol. 2016;33(7):1870-1874. doi: 10.1093/molbev/msw054.
  14. White TJ, Bruns T, Lee S, Taylor JW. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. PCR Protocols: A Guide to Methods and Applications. New York: Academic Press; 1990. P. 315-322.
  15. Rehner SA, Samuels GJ. Taxonomy and phylogeny of Gliocladium analysed from nuclear large subunit ribosomal DNA sequences. Mycol Res. 1994;98(6):625-34. doi: 10.1016/s0953-7562(09)80409-7.
  16. Vilgalys R, Hester M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J Bacteriol. 1990;172(8):4238-4246. doi: 10.1128/jb.172.8.4238-4246.1990.
  17. O’Donnell K, Cigelnik E. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol Phylogenet Evol. 1997;7(1):103-116. doi: 10.1006/mpev.1996.0376.
  18. Woudenberg JH, Aveskamp MM, de Gruyter J, et al. Multiple Didymella teleomorphs are linked to the Phoma clematidina morphotype. Persoonia. 2009;22:56-62. doi: 10.3767/003158509X427808.
  19. Van der Aa HA, Boerema GH, de Gruyter J Contributions towards amonograph of Phoma (Coelomycetes) VI-1. Section Phyilostictoides: Characteristics and nomenclature of its type species Phoma exigua. Persoonia. 2000;17(Pt 1): 435-456.
  20. Tsuchiya Y, McCourt P. Strigolactones: a new hormone with a past. Curr Opin Plant Biol. 2009;12(5):556-61. doi: 10.1016/j.pbi.2009.07.018.
  21. Matveeva TV, Sokornova SV, Lutova LA. Influence of Agrobacterium oncogenes on secondary metabolism of plants. Phytochem Rev. 2015;14(3):541-554. doi: 10.1007/s11101-015-9409-1.
  22. Tamura K, Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution. 1993;10:512-526.
  23. Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution. 1993;33:1870-1874.
  24. Felsenstein J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution. 1985;39: 783-791.
  25. Rai MK, Tiwari VV, Irinyi L, Kövics GJ. Advances in Taxonomy of Genus Phoma: Polyphyletic Nature and Role of Phenotypic Traits and Molecular Systematics. Indian J Microbiol. 2013;54(2):123-128. doi: 10.1007/s12088-013-0442-8.

Supplementary files

Supplementary Files Action
1. Fig. 1. Molecular Phylogenetic analysis by Maximum Likelihood method. The evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura-Nei model [22]. The bootstrap consensus tree inferred from 500 replicates [24] is taken to represent the evolutionary history of the taxa analyzed [24]. Branches corresponding to partitions reproduced in less than 40% bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (500 replicates) are shown next to the branches [24]. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Compo site Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. The analysis involved 21 nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding. All positions containing gaps and missing data were eliminated. There was a total of 295 positions in the final dataset. Evolutionary analyses were conducted in MEGA7 [23]. Disclaimer: Although utmost care has been taken to ensure the correctness of the caption, the caption text is provided “as is” without any warranty of any kind. Authors advise the user to carefully check the caption prior to its use for any purpose and report any errors or problems to the authors immediately (www.megasoftware.net). In no event shall the authors and their employers be liable for any damages, including but not limited to special, consequential, or other damages. Authors specifically disclaim all other warranties expressed or implied, including but not limited to the determination of suitability of this caption text for a specific purpose, use, or application View (114KB) Indexing metadata

Views

Abstract - 566

PDF (Russian) - 246

Cited-By


PlumX

Comments on this article

View all comments

Copyright (c) 2018 Sokornova S.V., Gasich E.L., Bemova V.D., Matveeva T.V.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies