Polymorphism of genes controlling low level of linolenic acid in lines from VIR flax genetic collection

Full Text

INTRODUCTION

Areas of flax oil in the world amount to 2.8 million ha. The Russia is the main producer of this culture (709,000 ha in 2016), as the European Union, Brazil, and Japan prohibited the import of transgenic flax grown in Canada [1]. However, in flax productivity, Russia is behind Canada, the United States, and France [2]. In the Russia, flax ranks fourth in profitability among the oil plants after sunflower, soy, and rape plant and can serve as a reserve plant to compensate for the deficit of the raw material in case of poor harvest of sunflower and soy not only in the South but also in any other regions of the Russia [3].

Flax oil contains five major fatty acids (FA): two saturated acids, i.e., palmitic acid (PAL, 16 : 0) and stearic acid (STE, 18 : 0) and three unsaturated acids, i.e., oleic acid (OLE, 18 : 1), linoleic acid (LIO, 18 : 2), and linolenic acid (LIN, 18 : 3). According to the position of the last double bond, LIO is attributed to ω6-acid, and LIN is attributed to ω3-acid. Flax oil usually contains approximately 50 % LIN, thanks to which it is used in many industries, but it rancidifies quickly, which hampers its nutritional use [4].

Flax CVs are split into high linolenic (HL) and low linolenic (LL) according to their purpose. There are 33 CVs in the Russia, and 4 of them are LL [5].

HL flax oil is indispensable for pharmaceutical and perfumery industries, soap production, and the paintwork industry [6]. It is critical for the oil to dry fast for the production of paints and drying oils, which is connected to its unsaturation as evaluated by the iodine value (IOD). Normally, it fluctuates in the range from 180 to 190 [7].

When using flax as a major food in case of celiac disease and other alimentary diseases for the replacement of cereal flour, it is recommended to follow the ω6/ω3acid ratio of 5–10/1 for usual food and 3–5/1 for dietary therapy. The major CVs have a ratio of ~0.25/1 [8]; therefore, to produce full-fat flour, LIN should be reduced.

The first LL cv Linola (Linola^TM) were developed in the 1970s in Canada [9]. They contained approximately 2 % LIN and are double-recessive homozygotes in complementary genes ln1 and ln2. The other CVs are successors of cv Linola and were obtained independently from it. They all are patented and unavailable for scientific studies.

The contents of different Fas interact. The plant genotype as well as the environmental conditions affects their ratio [10]. FA biosynthesis is well studied. Genes of stearoyl ACP desaturase (18 : 0 → 18 : 1) sad1 and sad2 were sequenced in 1994 (Singh et al., 1994, cit. ex [11]), genes of desaturase-2 (18 : 1 → 18 : 2) fad2a and fad2a were sequenced in 2007 (Khadake et al., 2009, cit. ex [11, 12]), and genes of desaturase-3 (18 : 2 → 18 : 3) fad3a and fad3b were sequenced in 2005 [13]. Genes of the start of FA biosynthesis, i.e., ketoacyl-CoA synthase (KAS), were sequenced in 2004 [14], but their function was determined in 2014, i.e., KASIII (acetylCoA + malonylCoA → 4 : 0), KASI (4 : 0 → 16 : 0), and KASII (16 : 0 → 18 : 0) [15].

Genes fad3a and fad3b (also known as ln1 and ln2) are also considered valuable for flax selection, as they code desaturase that converts LIO into LIN, which is required for processed oil but not desirable for food oil [15]. Genes fad3a and fad3b have the size of 3280 and 3002 bp, respectively, and contain 6 exons and 5 introns, each coding proteins with a length of 391 and 392 amino acids. The similarity of genes at the DNA level amounts to 85 %, and the similarity of amino acids amounts to 94 %. Genes differ in dimensions due to indels from 1 to 29 bp localized in introns. Six isoforms are known for fad3a, four of which do not result in ferment inactivation. The first one, A (8 alleles with synonym replacements), is the most widely spread, and isoforms B, C, and E (per 1–2 alleles) are rare. Isoforms D and E lost functionality due to nonsense mutations. Seven isoforms are known for fad3b, five of which do not result in ferment inactivation. These are isoforms A (four alleles), D (eight alleles), G (seven alleles), and E and F (two alleles each). Only two isoforms do not produce full-scale products: isoform B due to nonsense mutation in the first exon and isoform С due to the replacement of histidine with tyrosine in the first His box of the active center of desaturase [11].

Thus, selection modification of the FA content (FAC) of flax oil should be based on the search of spontaneous or induced mutations in genes fad3a and fad3b, the assessment of different combinations of alleles and genes, and the mandatory biochemical confirmation of the oil content modification.

The yellow color of seeds is important for the production of flax of food value. It is controlled by several genes as follows: s1, an inhibitor of anthocyanin specifies white deformed flower besides the yellow color of anthers and seeds; pf-ad controls the pink color of petals besides the yellow color of seeds; f^e determines the light blue corolla and spotted seeds; and ora1 determines the speckled seeds and orange anthers. Three organo-specific genes are responsible for light coloration of seeds, i.e., YSED1 and ysed2 (yellow) and rs1 (light yellow-brown) [16].

A lot of LL CVs were developed worldwide; however, it is not clear how changes of oil FAC affect the other traits. The authors of most CVs do not focus on the LL gene donors as well as on the methods of their selection and verification of the purity of variety. Therefore, the objectives are as follows: (1) identification of the polymorphism of oil seed FAC among the lines and CVs of flax, (2) examination of the link systems between FAC, plant height, and early ripeness of flax group contrast in LIN level, (3) development of CAPS markers for alleles of LL genes, and (4) verification of homozygosis of LL lines created blindly.

MATERIALS AND METHODS

To identify the polymorphism by FAC, 19 HL, 8 medium linolenic (ML), and 16 LL lines were studied (Table 1). Line gc-2 from the accession of old selection (l-1 from k-48) with red-brown seeds was used as the “wild type” (Fig. 1).

 

Fig. 1. Pedigree of hybrid origine lines involved in the study

 

Table 1

Characters of flax lines from VIR genetic collection and varieties participating in the experiment

Number according to VIR catalog or pedigree	Generation of inbreeding, line	Line progenitor		LIN	Seeds color	Identified genes
gc-2	l-1	k-48 (Altgausen sel., Russia)		HL	red-brown	wild type (w. t.)
gc-483	l-1	k-3713 (China)		HL	yellow	pf-ad?
gc-448	l-1	k-3730 (China)		HL	yellow	s1
gc-136	l-1	k-6634 (Mermilloid, Czechia)		HL	yellow	s1
gc-210	l-1	i-588294 (Б-125, Lithuania)		HL	red-brown	–
gc-1631	l-2-1	k-726 (Soletskiy kryazh Pscov reg., Russia)		ML	red-brown	–
gc-119	l-2-3	k-6210 (NP (RR) 38, India)		ML	red-brown	–
gc-395	l-1	i-601680 (Walaga, Australia)		LL	yellow	YSED1
gc-474	l-1	i-612949 (Amon, Czechia, Agritec)		LL	yellow	YSED1?2
gc-512	l-1	i-620803 (N852, Unknown)		LL	yellow	sfbs1?, YSED1?
gc-513	l-2	i-620804 (N853, Unknown)		LL	yellow	sfbs1?, YSED1?
gc-514	l-3	i-620805 (N854, Unknown)		LL	yellow	sfbs1?, YSED1?
gc-515	l-4	i-620806 (N858, Unknown)		LL	yellow	pf-ad?
gc-516	l-5	i-620807 (N864, Unknown)		LL	yellow	sfbs1?, YSED1?
k-86771	commercial variety	Istok, Russia, Penza NIISH		LL	yellow	YSED1?
k-88711	commercial variety	LM98, Russia, VNIIL, Torzok		LL	yellow	YSED1?
gc-390	l-1	i-595808 (Linola, Canada); LL		ML	yellow	YSED1
gc-393	l-2			HL	red-brown
gc-394	l-3			ML	red-brown
gc-523	l-8-1			LL	yellow	YSED1
gc-391	l-1-2	i-601679 (Eyre, Australia); LL		LL	yellow	sfbs1, YSED1
gc-472	l-3-1			HL	yellow	YSED1
gc-498	l-3-2			HL	yellow	YSED1
gc-441	l-4			LL	yellow	sfbs1, YSED1
gc-420	l-5			LL	yellow	sfbs1, YSED1
HL lines, used for hybridization
gc-65	l-3	k-3178 (local, Russia, Tver’ reg.)		HL	Red-brown with yellow speckles	ora1
gc-103	l-4	k-5896 (Lin 225, The Netherlands)		HL	yellow	s1
gc-109	l-3–2	k-6099 (Makovi M.A.G., Argentine)		HL	red-brown	wf1
gc-121	l-1–1	k-6272 (L. Dominion, North Ireland)		HL	pale yellow-brown	rs1
gc-173	l-1	i-548145 (48254,Ottawa 2152, Germany)		HL	yellow	ysed2
gc-392	l-1	gc-132 (l-1 from k-6608, Currong, Australia)	gc-103	HL	yellow
Lines originating from hybrids between parents with contrast levels of LIN
391 × 65-1	I43 l-1	gc-391	gc-65	HL	yellow	ora1, sfbs1, YSED1
391 × 65-2	I4 l-2			ML	yellow	ora1, sfbs1, YSED1
391 × 109-1	I4 l-1		gc-109	LL	yellow	wf1, YSED1
391 × 109-2	I4 l-2			ML	yellow	wf1, YSED1
391 × 109-3	I4 l-3			ML	yellow	sfbs1, wf1, YSED1
391 × 109-4	I4 l-4			LL	yellow	sfbs1, wf1, YSED1
391 × 109-5	I4 l-5			HL	yellow	sfbs1, wf1, YSED1
391 × 121-1	l-1		gc-121	HL	pale yellow-brown	sfbs1, sfc1, rs1
391 × 121-2	l-2			ML	pale yellow-brown	sfbs1, sfc1, rs1
391 × 173-1	l-1		gc-173	HL	yellow	sfbs1, sfc3-2, ysed2
391 × 173-2	l-2			HL	yellow	sfbs1, sfc3-2, ysed2
391 × 392-1	l-1		gc-392	LL	yellow	s1, sfbs1, YSED1
1 — Accession was not used in statistical analysis, 2 — from line phenotype without allelic test, 3 — 6 or more generations of inbreeding are not marked. LIN — linolenic acid. HL — high linolenic, ML — medium linolenic, LL — low-linolenic

 

Several lines were obtained from each of the two LL cv Linola and cv Eyre; they have different habits and differ in the level of LIN and the FA ratio. Some lines were obtained as a result of crossing of LL line gc-391 (l-2-1 from i-601679, Eyre, Australia) homozygous by genes YSED1 and sfbs1 (inhibition of anthocyanin synthesis in hypocotyls and flowers) with HL lines carrying other genes of the light color of seeds or genes of the economic traits and the further selection of stable forms but without FAC control. Among HL parents, gc-65 (l-3 from k-3178, Tver Province) is homozygous by gene ora1, early ripening, and two lines are obtained from it (HL and ML); gc-109 (l-32 from k-6099, Argentina) is homozygous by gene wf1 (white petals) connected to early blossom [17], and five lines are obtained from it (one HL, two ML, and two LL); gc-121 (l-1-1 from k-6272, Northern Ireland) is homozygous by gene rs1 and is involved in the development of two lines (HL and ML); gc-173 is homozygous by gene ysed2 and is involved in the development of two HL lines; and gc-392 (gc-132 × gc-103) is homozygous by genes s1 and sfbs1, and LL line was selected from its hybrid.

From 1995 to 2016, the lines were assessed for the duration of phases of vegetation period (VP) based on VIR Pushkin laboratories: germination—flowering of the first flower (T1), flowering of first flower—ripening of first boll (T2), and germination—ripening of first boll (Т3); the total (Ho) and technical (Ht) height and length of the inflorescense (Inf) were also taken into account. As the weather conditions in the years of examination were different, data were balanced by means of the method of reduced average values [18] to the early ripening standard. Then the average value for the entire period of examination was calculated for each line.

Oil FAC was assessed by means of gas liquid chromatography with mass spectrometry of the methyl ethers of FA using chromatograph Agilent 6850. The percent content of five Fas in the oil was determined: PAL, STE, OLE, LIO, and LIN as well as the LIO/LIN ratio.

The major characteristic of technical oil is its IOD. This is an indicator of FA oil unsaturation; the higher the IOD, the faster the oil dries. IOD was calculated according to the following formula (AOCS Method Cd 1c-85, cit. ex [11]):

IOD = 0.86 OLE + 1.732 LIO + 2.616 LIN,

where IOD is iodine value of oil and OLE, LIO, and LIN are the shares of oleic, linoleic, and linolenic acids in the oil, respectively.

Data were analyzed using programs Statistica 7.0 for Windows and the analysis package Excel 2007 for Windows [19, 20].

The interval for the minimum and maximum values of each indicator was calculated as lim ± НСР (the least significant difference, by Fischer) [21].

To define the effect of the flax group by LIN (HL, ML, and LL) on the plant height, early ripening, and oil FAC, one-way analysis of variance (ANOVA) was used. The share of factor effect (η², %) was calculated according to Fischer [21].

The difference between the flax grouped by LIN level was evaluated by the criterion of Tukey’s honestly significant difference for unequal selections with post hoc pairwise comparison of means after declining hypothesis Н0 about the absence of differences with the results of ANOVA [19, 20].

The analysis of correlation systems between traits was conducted for each flax group (as per Pearson) plotting correlation pleiade. Factors of correlation between the z-converted matrix of correlation were calculated for the assessment of the similarity of link systems for each of three groups. These traits demonstrate a similarity of matrix structure [22].

DNA was extracted from ten 2-day roots of flax seedling according to the standard technique for each li- ne [23].

A polymerase chain reaction was conducted in the volume of 20 μl. The mixture included DreamTaq™ Green Master Mix (2X) (Thermo Scientific), 5 pmol for each primer, and 1 μl DNA preparation. Primers were synthesized by “Eurogen” [24]. Primers flanking the area with supposed mutation in LuFAD3A gene were selected using the program idtdna.com [25]. Previously published primers and the protocol were used for the detection of mutations in LuFAD3B gene [13].

DNA was sequenced based on RC of SpbSU “Development of molecular and cellular technologies” and “Eurogen.” Reference sequences for gene LuFAD3A used in the work were HM991829.1, HM991830.1, HM991831.1, and JQ963128.1.

Gene sequences were aligned using the program tcoffee [26]. Nucleotide sequences were analyzed using the programs MEGA 7.0.21 [27] and UGENE1.290 [28].

RESULTS AND DISCUSSION

Using six generations of inbreeding from 26 heterogenic accessions of flax, 40 lines were obtained, of which 19 were HL, 7 were ML, and 14 were LL.

The traits of the examined lines were low varying (CV < 10 %; T1 and T3) or moderately varying (CV < 26 %; Ho, Ht, Inf, T2, PAL, STE, OLE, and IOD), and only those that were connected to linolenic acid synthesis (CV 26 %–146 %; LIO, LIN, and the LIO/LIN ratio) were high varying (Table 2).

The total plant height varied from 52 cm in some LL lines (gc-391, 512, 514, 516) to 95 cm of gc-2 (standards), and the technical length ranged from 33 cm (HL, gc-483; ML, gc-119; and LL, gc-391) to 75 cm (gc-2). ANOVA demonstrated significant differences of flax groups in all three traits. Differences in 10 cm between HL and LL by Tukey’s test were significant. Inflorescens I ranged from 13 cm (HL gc-103, 121, 136) to 26 cm (HL gc-483, 109, 173; LL gc-523) and almost did not differ in the flax groups (see Table 2; Fig. 2).

 

Fig. 2. The proportion of influence (η2) of the linolenic acid degree (HL — high linolenic, ML — medium linolenic, LL — low-linolenic) and random variation (error) according to the results of one-way analysis of variance (ANOVA). * differences between groups are significant; Ho — the total height; Ht — the technical height; Inf — the length of the inflorescence; T1 — the duration of the phase of germination — flowering of the first flower; T2 — the duration the phase flowering of the first flower — ripening of the first boll; T3 — the duration of the phase of the germination — ripenting of the first boll; PAL — palmitic acid; STE — stearic acid; OLE — oleic acid; LIO — linoleic acid; LIN — linolenic acid; IOD — iodine number; F is the Fisher criterion value; p is the probability of similarity of classes (HL, ML, LL); differences — significant differences of these classes according to the results of a posteriori comparison by the Tukey criterion for unequal sampling

 

Table 2

Parameters of the plants height, duration of vegetative period phases and fatty acids composition of seed oil in flax accessions that differ in the level of linolenic acid synthesis

Number according to VIR catalog or pedigree	Ho	Ht	Inf	T1	T2	T3	PAL	STE	OLE	LIO	LIN	LIO/ LIN	IOD
HL lines
gc-2	93	75	18	40	25	64	4	3	19	15	60	0,25	198
gc-65	70	52	17	39	26	65	4	3	21	17	55	0,30	192
gc-483	59	33	25	47	38	85	6	3	13	11	67	0,17	205
gc-448	64	42	22	40	41	81	6	2	14	12	67	0,17	209
gc-103	75	62	13	49	36	85	5	4	14	12	65	0,19	203
gc-109	75	49	26	43	40	82	4	3	23	15	55	0,27	190
gc-121	62	48	14	43	33	76	5	3	16	18	59	0,30	198
gc-136	72	59	14	47	36	84	5	5	15	14	62	0,22	198
gc-173	78	52	26	45	38	83	5	5	18	20	53	0,37	187
gc-210	84	63	20	43	32	75	5	5	23	19	48	0,40	180
gc-393	79	60	19	55	48	103	6	3	21	13	57	0,22	189
gc-472	57	38	20	45	41	85	7	5	15	20	52	0,39	185
gc-498	56	37	19	45	41	86	3	2	13	20	61	0,33	206
gc-392	63	41	22	42	38	80	5	5	20	15	54	0,28	186
391 × 65-1	74	57	17	53	28	81	6	3	23	16	51	0,31	183
391 × 109-5	64	47	18	41	34	75	5	3	27	17	49	0,34	179
391 × 121-1	68	53	15	46	36	82	5	4	25	21	46	0,45	177
391 × 173-1	64	44	20	46	40	86	4	2	9	18	66	0,27	212
391 × 173-2	72	50	22	48	40	88	6	5	17	19	53	0,35	187
Average	70 ± 2	51 ± 2	19 ± 1	45 ± 1	36 ± 1	81 ± 2	5 ± 0	4 ± 0	18 ± 1	16 ± 1	57 ± 1	0,29 ± 0,02	193 ± 2
CV	14	21	21	10	16	10	19	29	26	19	11	27	6
ML lines
gc-163							7	3	28	19	43	0,44	169
gc-119	59	36	22	41	36	77	5	4	34	17	39	0,44	161
gc-390	74	55	19	47	31	78	5	3	17	32	44	0,72	184
gc-394	80	59	21	48	32	80	5	4	20	37	34	1,08	170
391 × 65-2	76	60	16	54	27	81	6	4	19	35	36	0,96	171
391 × 109-2	64	46	17	41	34	75	5	4	29	48	14	3,46	144
391 × 109-3	60	45	15	45	34	78	5	4	25	29	37	0,78	168
391 × 121-2	67	46	20	45	38	83	5	5	29	21	41	0,51	167
Average	68 ± 3	50 ± 3	19 ± 1	46 ± 2	33 ± 1	79 ± 1	5 ± 0	4 ± 0	25 ± 2	31 ± 4	35 ± 4	1,14 ± 0,40	166 ± 5
CV	12	18	15	10	10	3	8	15	26	33	28	92	7
LL lines and commercial varieties
gc-523	74	48	25	49	32	81	6	4	17	67	6	12,00	146
gc-391	53	35	18	42	42	85	6	4	23	60	7	9,07	142
gc-441	59	42	17	41	44	85	7	3	27	62	2	29,27	135
gc-420	56	37	19	42	41	83	7	4	18	69	3	22,78	142
gc-395	58	38	20	45	40	85	7	3	19	69	2	31,26	141
gc-474	74	52	22	53	41	94	7	4	16	72	1	49,33	142
gc-512	52	37	15	43	41	84	7	5	24	61	3	23,51	134
gc-513	57	38	18	43	40	82	7	6	27	58	2	31,99	129
gc-514	55	38	17	43	40	84	7	4	19	69	2	34,74	140
gc-515	62	40	22	48	38	86	6	4	18	68	3	26,07	141
gc-516	52	37	15	43	39	82	6	4	22	66	2	37,31	138
391 × 109-1	58	42	16	41	33	74	6	4	26	62	1	42,66	135
391 × 109-4	64	45	19	42	34	76	4	4	24	62	6	10,18	145
391 × 392-1	61	40	21	43	39	82	3	2	16	75	4	19,60	154
k-8677							6	4	13	75	2	47,18	145
k-8871							7	3	19	69	2	33,84	141
Average	60 ± 2	41 ± 1	19 ± 1	44 ± 1	39 ± 1	83 ± 1	6 ± 0	4 ± 0	21 ± 1	66 ± 1	3 ± 0	27 ± 3	140 ± 2
CV	12	12	16	8	9	6	19	24	20	8	57	44	4
General average	66 ± 2	47 ± 2	19 ± 1	45 ± 1	37 ± 1	82 ± 1	5 ± 0	4 ± 0	20 ± 1	36 ± 4	34 ± 4	10 ± 2	170 ± 4
LSD	3	3	1	1	2	2	0,3	0,3	2	7	8	5	8
CV	15	20	18	9	14	8	20	25	26	64	74	149	15
Note: Ho — the total height; Ht — the technical height; Inf — the length of the inflorescence; T1 — the duration of the phase of germination — flowering of the first flower; T2 — the duration the phase flowering of the first flower — ripening of the first boll; T3 — the duration of the phase of the germination — ripenting of the first boll; PAL — palmitic acid; STE — stearic acid; OLE — oleic acid; LIO — linoleic acid; LIN — linolenic acid; IOD — iodine number; Minimum values selected by Tukey HSD criterion are indicated in italics maximum values are indicated in bold

 

The most early ripening HL lines were gc-2 and gc-65, which had short three VPs (T1 = 39, T2 = 25, and T3 = 64 days) and for late ripening was HL gc-393, a mutant from LL line of cv Linola (T1 = 55, T2 = 48, and T3 = 103 days). HL gc-448 (40 days) and ML l-2 from gc-391 × gc-65 (54 days) were distinguished only for the duration of the germination—flowering period. With the results of ANOVA, no differences were detected between flax groups as per T1 and T3; however, significant differences by T2 were detected. On the other hand, the maximum differences in 6 days between flax groups for T2 as per Tukey’s test were insignificant (see Table 2; Fig. 2).

The content of PAL in oil varied from 3 % (HL, gc-2, gc65, and gc498, l-1 from gc-391 × gc-173; LL, l-1 from gc-391 × gc-392) to 7 % (HL, gc-472; ML, gc-163; LL, gc-441, gc-420, gc-395, gc-474, gc-512, gc-513, gc-514, and gc-8871). ANOVA demonstrated significant differences for flax groups for this trait. Differences of 1 % between HL and LL by Tukey’s test were significant; the same differences between HL and ML were not detected due to little sampling (see Table 2; Fig. 2).

The content of STE in oil varied from 2 % (HL, gc-498, l-1 from gc-391 × gc-173; LL, l-1 from gc-391 × gc-392) to 6 % (LL, gc-513) and did not differ significantly in flax groups (see Table 2; Fig. 2).

The content of OLE in oil varied from 9 % (HL, l-1 from gc-391 × gc-173) to 34 % (ML, gc-119). ANOVA demonstrated significant differences for flax groups in this trait stipulated by differences in 7 % between ML and HL by Tukey’s test (see Table 2; Fig. 2).

The share of effect of flax group (η²) on the above-described traits with significant differences varied from 17 % to 25 %. For flax groups connected to LIN level in all traits, ANOVA demonstrated significant differences, and the share of effect varied from 77 % to 95 %, which was caused by the concept of division into groups (see Fig. 2).

The content of LIO in oil varied from 11 % to 75 % (HL, 11–21 %; ML, 17–48 %; and LL, 58–75 %). The lowest percent of LIO was demonstrated in almost all HL lines (gc-483, gc-448, gc-103, etc.); the highest percent was demonstrated in almost all LL lines (l-1 из gc-391 × gc-392, k-8677, gc-474, etc.; see Table 2). Tukey’s test demonstrated significant differences for all three flax groups.

The content of LIN in oil varied from 1 % to 67 % (HL, 46–67 %; ML, 14–44 %; LL, 1–7 %). The lowest percent of LIN was demonstrated in all LL accessions; the highest were HL gc-483, gc-448, etc. (see Table 2). Tukey’s test demonstrated significant differences for all three flax groups (see Fig. 2).

The LIO/LIN ratio varied from 0.17 to 49.33 (HL, 0.17–0.45; ML, 0.44–3.46; and LL, 9.07–49.33). Minimum values were demonstrated by all HL flax, maximum LL. The LIO/LIN ratio is a strongly varied trait (CV 149 %). However, in HL form, it is more permanent (CV 27 %) than in ML (CV 92 %) and LL (CV 44 %). ANOVA demonstrated significant differences for flax groups by this trait (see Table 2); in terms of Tukey’s test, only LL had a significant difference from HL and ML forms (see Fig. 2).

Only the oil of l-2 from gc-391 × gc-109 of all studied accessions can be used for nutritional therapy “as it is”; for dietary therapy, two lines of CVs gc-391 and gc-523 as well as hybrid lines l-4 from gc-391 × gc-109 can be used. The rest of the oils require blending.

The IOD of oil varied from 129 to 212 (HL, 177–212; ML, 161–184; and LL, 129–154). The smallest value was demonstrated by LL gc-441, gc-512, gc-513, l-1 from gc-391 × gc-109; the highest one was demonstrated by HL gc-483, gc-448, gc-472, l-1 from gc-391 × gc-121 (see Table 2). Tukey’s test demonstrated significant differences for all three groups of flax (see Table 2; Fig. 2).

FAC in seeds sometimes correlates with VP phases and heights. As described previously [10], changes in the seeds in the reduction of LIN synthesis cause nonsymmetric changes in the FA ratio, which affects the correlation between them. In all three groups of flax, two ollecti of correlated traits were detected. Only a few correlations coincided in each of them: in the first one, heights are closely connected to each other as Ht amounts to approximately 90 % of Ho; in the center of the second one, the content of LIN in oil negatively correlates with the LIO/LIN ratio and positively correlates with IOD. Similar to the first case, this is the result of arithmetic regularities of the calculation of the last two traits (Fig. 3).

In HL lines, the first pleiade is formed with duration of VP (T3) closely positively correlated to its phases (T1 and T2) as well as moderately positively with PAL, formed at the beginning of the biosynthesis of FA. T2 negatively correlates with Ht, which in turn is very strongly positively connected to Ho. The second pleiade, besides its very strong positive correlation with LIN and IOD and strong negative correlation with the LIO/LIN ratio as well as its strong negative correlation between the latter ones, has a strong negative correlation of OLE with LIN and IOD as well as a moderate negative correlation of latter ones with STE. LIO is strongly positively connected to the LIO/LIN ratio and moderately negatively connected to LIN. Fas negatively correlated with LIN are its precursor. Inf is independent from any other traits (see Fig. 3).

 

Fig. 3. Correlation pleiades of traits of pland height, duration of phases of vegetative period and the fatty acid composition of seed oil of flax accessions, differing in the level of linolenic acid synthesis: a — high linolenic; b — medium linolenic; c — low linolenic. Ho — the total height; Ht — the technical height; Inf — the length of the inflorescence; T1 — the duration of the phase of germination — flowering of the first flower; T2 — the duration the phase flowering of the first flower — ripening of the first boll; T3 — the duration of the phase of the germination — ripenting of the first boll; PAL — palmitic acid; STE — stearic acid; OLE — oleic acid; LIO — linoleic acid; LIN — linolenic acid; IOD — iodine number

 

The group of ML lines is small in number, the correlation between its traits is significant at r > 0.75, and many strong and all moderate correlations cannot be taken into account. The first pleiade is formed by T1, besides the heights, which is strongly positively connected to Ht; they both negatively correlate with T2. The content of OLE strongly negatively correlates with the first two traits. The second pleiade is formed with positively strongly correlated in pairs LIO and IOD as well as with LIO and the LIO/LIN ratio. These two groups negatively correlate with each other. Inf, T3, and the content of saturated acids do not depend on any other traits (see Fig. 3).

In LL lines, the first pleiade is formed with heights, and T1 and Inf are positively connected to each other. T1 positively correlates with T3, and T2 is positively correlated to it. The center of the second pleiade is shifted for IOD, which is positively connected to LIO (strongly) and LIN (moderately) and negatively with OLE, STE, and PAL. LIO also strongly negatively correlates with OLE and moderately with STE; the latter one in turn is positively connected to PAL. LIN very strongly negatively correlates with the LIO/LIN ratio as the variability of LIN determines the variance of this ratio. Pleiades are connected to one another with moderate negative correlation of OLE with T1 and Inf; the latter has positive correlation with IOD (see Fig. 3).

Correlations between the z-converted matrix of correlations for flax groups demonstrated their moderate similarity (r_HL-ML = 0.50, r_HL-LL = 0.42, and r_ML-LL = 0.54), which is mostly stipulated with arithmetic regularities of trait measurement/calculation.

Using factor analysis (principle components method), two major factors were detected that affect the examined traits (Fig. 4).

 

Fig. 4. Factor loading for 13 studied traits (а) and factor scores for 40 lines of flax (b) in the system of two factors. Ho — the total height; Ht — the technical height; Inf — the length of the inflorescence; T1 — the duration of the phase of germination — flowering of the first flower; T2 — the duration the phase flowering of the first flower — ripening of the first boll; T3 — the duration of the phase of the germination — ripenting of the first boll; PAL — palmitic acid; STE — stearic acid; OLE — oleic acid; LIO — linoleic acid; LIN — linolenic acid; IOD — iodine number . HL — high linolenic, SL — medium linolenic, NL — low-linolenic

 

The first factor determines the LIO/LIN ratio. It indicates antagonism LIN, IOD, and the heights of plants (Ho and Ht) on the one hand and the LIO, PAL, and the LIO/LIN ratio on the other hand. It characterizes approximately 40 % of the total variance. This factor with small overlap separated LL lines from HL. ML lines took intermediate position. It is interesting that overlapping toward LL is caused by the availability of ML heterozygosis in selection (l-2 from gc-391 × gc-109) as well as revertant to HL from LL CV (gc-472).

The second factor determines early ripening and demonstrates antagonism to duration of all three phases of VP on the one hand and OLE on the other hand. It explains approximately 20 % of the total variability. This factor distinguished early ripening, as a rule, high oleic gc-2, gc-65, and l-1, l-2, l-4, l-5 from gc-391 × gc-109, and experimentally late ripening low oleic gc-393 as well as late ripening low oleic gc-483, gc-472, l-1 and l-2 from gc-391 × gc-173.

In the system of two factors, three groups of lines were split: (1) LL, gc-391, gc-441, gc-420, gc-395, gc-512, gc-513, gc-514, gc-515, and gc-516, with lowest amount of LIN and the highest LIO; (2) the most early ripening and HL gc-2 and gc65; and (3) two sister lines LL l-2 and ML l-4 from gc-391 × gc-109 as early ripening. Experimental late ripening HL gc-393 and late ripening gc-474 are separate from others: LL and low oleic.

Thus, factor analysis allows grouping lines in correlated traits and characterizing them in complex.

A new method of identification of alleles of LuFAD3A gene was developed for the search of differences between lines LL and ML by genes of biosynthesis of LIN, which controls its formation. An analysis of available NCBI sequences of alleles of LuFAD3A gene demonstrated that in most LL accessions, the mutation-inhibiting synthesis of LIN is in the first exon of the gene. Primers FAD3Ae1F (acttggcatcctgcattactt) and FAD3Ae1R (ccagaaagataatgtgaaattacc) were constructed that fix this area. The product of amplification has a length of 526 bp. When it is sequenced, each of mutant allele LuFAD3A of lines gc-391 and gc-515 similar replacements is detected in position 28 (G → A), position 255 (G → A), and position 309 (A → G) of the first exon, which indicates the identity of alleles between one another and the full similarity with sequence from the NCBI for genotype SP2047 (HM881831). The replacement in position 255 (G → A) results in the formation of termination codon.

The use of restrictase HaeIII allows to identify the mutant allele containing replacement G₂₅₅ → A₂₅₅. Two sites of restriction are available within the amplified fragment of the allele (Fig. 5). When it is decomposed, fragments 85, 90, and 351 bp are formed. The mutation specified above is in position 442 of the product of amplification and affects one of the two sites of restriction, which results in the formation of fragments 90 and 436 (351 + 85) bp. Thus, we proposed a new option of CAPS marker. It helps to identify that CVs ЛМ98 and Istok, as well as lines from LL cv Linola (gc-390 and gc-523), Eyre (gc-391, gc-441, and gc-420), Walaga (gc-395), Amon (gc-474), and accessions 852, 853, 854, 858, and 864 (gc-512–gc-516), are homozygous in mutation in this area of gene (Table 3).

 

Fig. 5. Molecular marking of LuFAD3A (a–с) and LuFAD3B (d–f) gene: a, d — restriction map of the gene fragment; b, e — chromatograms of the wild type (gc-2) and mutant (gc-391), SNP are marked by arrows; c, f — electrophoregram of restriction products of PCR fragment. HL — high linolenic, ML — medium linolenic, LL — low-linolenic

 

Table 3

Polymorphism of flax lines’ LuFAD3A gene according to the length of restriction fragments (CAPS markers)

Number according to VIR catalog or pedigree	LIN, %	Fragment length (bp)		Allele	Number according to VIR catalog or pedigree	LIN, %	Fragment length (bp)		Allele
		1	2				1	2
HL lines					ML lines
gc-2	58	330	100	w. t.	gc-163	43	330	100	w. t.
gc-65	50	330	100	w. t.	gc-119	33	330	100	w. t.
gc-483	66	330	100	w. t.	gc-390	41	430	100	mut.
gc-448	67	330	100	w. t.	gc-394	34	330	100	w. t.
gc-103	61	330	100	w. t.	391 × 65-2	36	430	100	mut.
gc-109	46	330	100	w. t.	391 × 109-2	14	430+330	100	w. t. + mut.
gc-121	58	330	100	w. t.	391 × 109-3	37	430	100	mut.
gc-136	61	330	100	w. t.	391 × 121-2	41	330	100	w. t.
gc-173	55	330	100	w. t.	LL lines
gc-210	48	330	100	w. t.	gc-523	6	430	100	mut.
gc-393	57	330	100	w. t.	gc-391	5	430	100	mut.
gc-472	52	330	100	w. t.	gc-441	2	430	100	mut.
gc-498	61	330	100	w. t.	gc-420	3	430	100	mut.
gc-392	54	330	100	w. t.	gc-395	2	430	100	mut.
391 × 65-1	51	330	100	w. t.	gc-474	2	430	100	mut.
391 × 109-5	49	330	100	w. t.	gc-512	3	430	100	mut.
391 × 121-1	46	430	100	mut.	gc-513	2	430	100	mut.
391 × 173-1	66	330	100	w. t.	gc-514	2	430	100	mut.
391 × 173-2	53	330	100	w. t.	gc-515	3	430	100	mut.
					gc-516	2	430	100	mut.
					391 × 109-1	1	430	100	mut.
					391 × 109-4	6	430	100	mut.
					391 × 392-1	4	430	100	mut.
					k-8677	2	430	100	mut.
					k-8871	2	430	100	mut.

 

For the second gene, LuFAD3B, the previously published protocol was used for the detection of mutation in the first exon [13]. The product of amplification has a length of 468 bp. When it is sequenced, the mutant alleles of lines gc-391 and gc-515 detected replacement in position 6 (С → T) of the second exon, which resulted in the replacement of Hys → Tyr. It was shown that the use of restrictase BsaJI allows to identify the mutant allele. Two sites are available for restrictase within the amplified fragment of allele of the wild type (Fig. 5). Fragments with a length of 191, 240, and 37 bp are formed during its decomposition. The mutations specified above are in position 431 of the product of amplification and involve one of the three restriction sites, which results in the formation of fragments with a length of 191 and 277 (240 + 37) bp. A restriction product of 37 bp of HL forms is combined with the low molecular nonspecific products of amplification; the one gets false impression about the difference of HL and LL forms in size of the larger product of amplification. Thus, the CAPS marker proposed previously for genotypes 593 to 708 can be used for gc-391. It was detected that lines from LL CVs Linola (gc-394), Eyre (gc-391, 420), and Walaga (gc-395) and accession 858 (gc-515) are homozygous by mutation in this area of gene (Table 4). Based on the available data of the NCBI sequences of allele of LuFAD3B gene (KF026416), it was detected that cv Amon has the same point mutation as gc-391.

 

Table 4

Polymorphism of flax lines’ LuFAD3B gene according to the length of restriction fragments (CAPS markers)

Number according to VIR catalog or pedigree	LIN, %	Fragment length (bp)		Allele	Number according to VIR catalog or pedigree	LIN, %	Fragment length (bp)		Allele
		1	2				1	2
HL lines					ML lines
gc-2	58	240	191	w. t.	gc-119	33	240	191	w. t.
gc-65	50	240	191	w. t.	gc-390	41	240	191	w. t.
gc-109	46	240	191	w. t.	gc-394	34	277	191	mut.
gc-136	61	240	191	w. t.	LL lines
gc-173	55	240	191	w. t.	gc-391	5	277	191	mut.
gc-393	57	240	191	w. t.	gc-420	3	277	191	mut.
					gc-395	2	277	191	mut.
					gc-515	3	277	191	mut.

 

LL cv Eyre (Australia) was one of the first to come to VIR ollection that was heterogeneous by LL genes. Several lines were obtained on its basis, but only one line is used for crossing (gc-391). By means of obtained markers, homozygosis of hybrids from cross-breeding of LL (gc-391) and HL lines (see Table 3; Fig. 5) by gene LuFAD3A was confirmed. Progeny F₇ l-1, 1-3, 1-4 from hybrid gc-391 × gc-109, l-2 from hybrid gc-391 × gc-65 and progeny F₉ l-1 from hybrid gc-391 × gc-392 are homozygous by recessive allele of LuFAD3A gene. Progeny F₉ l-1, l-2 from hybrid gc-391 × gc-121, gc-391 × gc-121 and progeny F₇ l-1 gc-391 × gc-65, l-5 from hybrid gc-391 × gc-109 are homozygous by the dominant allele of this gene. Progeny F₇ l-2 from hybrid gc-391 × gc-109 appeared to be heterozygous by this gene. Line l-2 from gc-391 × gc-121 is interesting: it is homozygous by the recessive allele of LL gene with the results of DNA analysis, but it has the boundary content of LIN; therefore, it was attributed to HL instead of ML. Thus, parental line gc-121 has a different way to slightly increase the level of LIN. Although the references describe only two genes responsible for LIN synthesis, according to our information, the genetic surrounding is rather important.

The LL CVs available for us are late ripening and are not adapted to the conditions of Russia; therefore, the study objective was to select prospective early ripening forms. It was shown that hybrids, in which breeding record the line gc-109 presented, were ripen 8 to 10 days earlier than the parental LL line gc-391. The most prospective ML line l-3 and LL lines l-1 and l-4 were from the crossing of gc-391 × gc-109.

CONCLUSION

Lines of VIR flax genetic collections have a wide variety of FA oil. A sharp reduction of the synthesis of LIN causes nonsymmetric changes in the FA ratio, which effects the correlation between them and other traits. Factor analysis clearly splits the lines by the level of LIN and the traits connected to it. Primers were constructed, restrictases were selected, and an experiment protocol was developed for the identification of alleles of LuFAD3A gene. It was determined that all LL forms available in the VIR collection have mutation in the first exon (G₂₅₅ × A₂₅₅) of this gene. The test system [13] developed for mutation identification in the first exon of LuFAD3B gene of genotypes 593 to 708 can be used for mutation in the second exon of gc-391, etc.

Four generations of inbreeding are sufficient in most cases for the selection of homozygous forms.

Acknowledgments

The work was done with the financial support of program VIR No. 066220180005 ААААА161160407103663 “Identification and mapping of genetic pool of the most important agricultural crops, formation of genetic collections with valuable for selection alleles of genes and quantitative traits.”

The authors express their gratitude to the RC of SpbSU “Development of molecular and cellular technologies” and personally to E.Yu. Gorodilov and A.E. Masharsky for support in DNA sequencing.

About the authors

Elizaveta A. Porokhovinova

Federal Research Centre N.I. Vavilov All-Russian Institute of Plant Genetic Resources (VIR)

Author for correspondence.
Email: e.porohovinova@mail.ru
ORCID iD: 0000-0002-8328-9684
SPIN-code: 5033-3263
Scopus Author ID: 22986519000
ResearcherId: S-6756-2016

PhD, Senior Researcher, Oil and Fibre Crops Department

Russian Federation, 42,44, B. Morskaya Street, St. Petersburg, 190000

Tatyana V. Shelenga

Federal Research Centre N.I. Vavilov All-Russian Institute of Plant Genetic Resources (VIR)

Email: tatianashelenga@yandex.ru
Scopus Author ID: 37069721500

PhD, Leader Researcher, Department of Biochemistry and Molecular Biology

Russian Federation, 42,44, B. Morskaya Street, St. Petersburg, 190000

Tatyana V. Matveeva

Saint Petersburg State University

Email: radishlet@gmail.com
ORCID iD: 0000-0001-8569-6665
SPIN-code: 3877-6598
Scopus Author ID: 7006494611
ResearcherId: J-6000-2013

Doctor of science, Professor, Chair of Genetics and Biotechnology

Russian Federation, 199034 , St. Petersburg, Universitetskaya Emb, 7/9  

Andrey V. Pavlov

Federal Research Centre N.I. Vavilov All-Russian Institute of Plant Genetic Resources (VIR)

Email: avpavlov77@yandex.ru
Scopus Author ID: 22986534600

PhD, Senior Researcher, Oil and Fibre Crops Department

Russian Federation, 42,44, B. Morskaya Street, St. Petersburg, 190000

Elizaveta A. Grigorieva

Federal Research Centre N.I. Vavilov All-Russian Institute of Plant Genetic Resources (VIR)

Email: e.grigoreva@vir.nw.ru

Master Student, Laboratory of Monitoring Genetic Erosion

Russian Federation, 42,44, B. Morskaya Street, St. Petersburg, 190000

Nina B. Brutch

Federal Research Centre N.I. Vavilov All-Russian Institute of Plant Genetic Resources (VIR)

Email: n.brutch@vir.nw.ru
SPIN-code: 1753-4382
Scopus Author ID: 26665888600

Doctor of Science, Main Researcher, Oil and Fibre Crops Department

Russian Federation, 42,44, B. Morskaya Street, St. Petersburg, 190000

References

Supplementary files