Polymorphism of genes controlling low level of linolenic acid in lines from VIR flax genetic collection

Cover Page

Abstract


Background. Linseed solin varieties were created for nutrition, but the effect of oil fatty acid (FA) composition on other characters is not clear.

Materials and methods. Using 6 inbreeding generations from 26 heterogeneous flax accessions were generated 19 high (HL), 7 medium (ML) and 14 low linolenic (LL) lines. For each lines contents of 5 basic FA: palmitic, stearic, oleic (OLE), linoleic (LIO) and linolenic (LIN); the ratio LIO/LIN, oil iodine number, vegetative period (VP) phases and plants size were evaluated. Development of CAPS marker for LuFAD3A gene was performed using idtdna.com. Sequencing of LIN genes sites was done in the Centre MCT SPBGU and Eurogen.

Results. ANOVA showed significant differences HL, ML and LL groups for PAL, OLE, LIO, LIN, LIO/LIN, IOD. Considerable decrease of LIN, causes asymmetric changes in FA ratio and correlations between them and other traits. Factor analysis revealed the influence of two factors. The first one divided lines according to their LIN level and characters associated with it, the second one – according to the VP and OLE. LIN synthesis is controlled by two complementary genes LuFAD3A and LuFAD3B. Sequencing of LuFAD3A gene 1 exon of 6 lines revealed a mutation (G255 → A255), resulting in formation of stop codon. Developed developed CAPS-marker confirmed the homozygosity of hybrids between LL (gc-391) and HL lines (gc-65, 109, 121). Descendants of hybrid between gc-109 and gc-391 ripened 8-10 days earlier than gc-391. CAPS markers of LuFAD3B gene revealed differences between HL, ML, LL lines. Sequencing of this gene first exon and the beginning of the second one in 3 lines (1HL, 2LL) showed that this method reveals a mutation in the second restriction site, located in the 2 exon (C6 → T6), and causing the replacement Hys → Tyr.

Conclusion. Lines from GC have wide variability of FA and other agronomic characters, combination of which will expand the cultivation of solin.


ВВЕДЕНИЕ

Площади масличного льна в мире составляют 2,8 млн га. Сейчас РФ является основным производителем этой культуры (709 тыс. га в 2016 г.), так как Евросоюз, Бразилия и Япония запретили ввоз трансгенного льна, возделываемого в Канаде [1]. Однако по продуктивности льна Россия уступает Канаде, США и Франции [2]. В РФ лен занимает четвертое место по доходности среди масличных культур после подсолнечника, сои и рапса и может служить резервной культурой для восполнения дефицита сырья в случае неурожая подсолнечника и сои не только на Юге, но и в других регионах РФ [3].

Масло льна содержит пять основных жирных кислот (ЖК): две насыщенные — пальмитиновую (PAL, 16 : 0) и стеариновую (STE, 18 : 0) и три ненасыщенные — олеиновую (OLE, 18 : 1), линолевую (LIO, 18 : 2) и линоленовую (LIN, 18 : 3). По положению последней двойной связи LIO относится к ω6-, а LIN — к ω3-кислотам. Льняное масло обычно содержит около 50 % LIN, благодаря чему его применяют во многих отраслях, но оно быстро прогоркает, что затрудняет его пищевое использование [4].

Сорта льна по своему назначению делятся на высоколиноленовые (ВЛ) и низколиноленовые (НЛ). В РФ районировано 33 сорта, из них четыре НЛ [5].

Высоколиноленовое льняное масло незаменимо в фармацевтической, парфюмерной, косметической, мыловаренной, лакокрасочной промышленности [6]. Для производства олиф и красок необходимо, чтобы масло быстро высыхало, что связано с его ненасыщенностью, которую оценивают по йодному числу. В норме оно колеблется от 180 до 190 [7].

При использовании льна как основного продукта питания при цилиакии и других алиментарных заболеваниях для замещения муки злаков рекомендуют соблюдать соотношение ω6/ω3-кислот 5–10/1 для обычного питания и 3–5/1 — для лечебного. Большинство сортов имеют соотношение ~0,25/1 [8], поэтому для производства полножирновой муки надо уменьшать содержание LIN.

Первые НЛ-сорта LinolaTM были созданы в 1970-х гг. в Канаде [9]. Они содержат около 2 % линоленовой кислоты и являются двойными рецессивными гомозиготами по комплементарным генам ln1 и ln2. Другие сорта — потомки сорта Linola или получены независимо от него. Все они запатентованы и недоступны для научных исследований.

Содержание разных ЖК взаимосвязано. На их соотношение оказывают влияние как генотип растения, так и условия окружающей среды [10]. У льна биосинтез ЖК хорошо изучен. Гены стеароил-АСР-десатуразы (18 : 0 → 18 : 1) sad1 и sad2 секвенированы в 1994 г. (Singh et al., 1994, цит. по [11]), гены десатуразы-2 fad2a и fad2a — в 2007 г. (18 : 1 → 18 : 2) (Khadake et al., 2009, цит. по [11]; [12]), гены десатуразы-3 fad3a и fad3b (18 : 2 →18 : 3) — в 2005 г. [13]. Гены начала биосинтеза жирных кислот — кетоацил-CoA-синтазы (KAS) секвенированы в 2004 г. [14], но их функция определена в 2014 г. — KASIII (Acetyl-CoA+Malonil-CoA → 4 : 0), KASI (4 : 0 → 16 : 0), KASII (16 : 0 → 18 : 0) [15].

Ценными для селекции льна считают гены fad3a и fad3b (они же ln1 и ln2), так как они кодируют десатуразы, превращающие линолевую кислоту в линоленовую, необходимую для технического масла, но нежелательную для пищевого [15].

Гены fad3a и fad3b имеют размер 3280 и 3002 п. н. соответственно и содержат по 6 экзонов и 5 интронов, кодируя белки длиной 391 и 392 аминокислоты. Сходство генов на уровне ДНК составляет 85 %, сходство аминокислотных последовательностей — 94 %. По размеру гены различаются из-за инделей от 1 до 29 п. н., локализованных в интронах. Для Fad3a известно шесть изоформ, четыре из которых не приводят к инактивации фермента. Первая, A (8 аллелей с синонимичными заменами) — самая распространенная, изоформы B, C, E (по 1–2 аллели) встречаются редко. Изоформы D и E потеряли функциональность из-за нонсенс-мутации. Для Fad3b известно семь изоформ, пять из которых не приводят к инактивации фермента. Это изоформы A (4 аллели), D (8 аллелей), G (7 аллелей), E, F (по 2 аллели). Только две изоформы не дают полноценного продукта: B — из-за нонсенс-мутации в первом экзоне и С — в связи с заменой гистидина на тирозин в первом His-box активного центра десатуразы [11].

Таким образом, селекционное изменение жирнокислотного состава (ЖКС) масла льна должно основываться на поиске спонтанных или индуцированных мутаций в генах fad3a и fad3b, оценке различных комбинаций аллелей и генов и обязательном биохимическом подтверждении изменения состава масла.

Желтосемянность важна для производства льна пищевого назначения. Ее контролируют несколько генов: s1 — ингибитор антоциановой окраски, помимо желтой окраски пыльников и семян обусловливает белый деформированный цветок, pf-ad — помимо желтого цвета семян контролирует розовую окраску венчика, fe — определяет светло-голубой венчик и пятнистые семена, ora1 — определяет крапчатые семена и оранжевые пыльники. Три органоспецифичных гена отвечают только за светлую окраску семян — YSED1 и ysed2 (желтую), rs1 (светло-желто-коричневую) [16].

В мире создано большое количество НЛ-сортов, но не ясно, как изменение ЖКС масла повлияло на другие признаки. Авторы большинства сортов не акцентируют внимание на донорах генов НЛ, а также способах их отбора и проверки сортовой чистоты, поэтому в задачи работы входило: 1) выявление полиморфизма ЖКС масла семян среди линий и сортов льна; 2) изучение систем связей между ЖКС, высотой растения и скороспелостью групп льна, контрастных и по уровню LIN; 3) разработка CAPS-маркеров на аллели генов НЛ; 4) проверка гомозиготности НЛ-линий, созданных вслепую.

МАТЕРИАЛ И МЕТОДЫ

Для выявления полиморфизма по ЖКС было изучено 19 ВЛ-, 8 СЛ- и 16 НЛ-линий (табл. 1). В качестве «дикого типа» использовали линию гк-2 из образца стародавней селекции (л-1 из к-48) с красно-коричневыми семенами (рис. 1).

 

Рис. 1. Родословная линий гибридного происхождения, участвующих в исследовании

 

Таблица 1

Характеристика линий генетической коллекции льна ВИР и сортов, использованных в исследовании

Номер по каталогу ВИР или родословная

Поколение инцухта, линия

Название и происхождение родителя(ей)

LIN

Окраска семян

Идентифицированные гены

гк-2

л-1

к-48 (сел. Альтгаузена, Россия)

ВЛ

красно-коричневая

«дикий тип»

гк-483

л-1

к-3713 (Китай, к северу от Кашагара)

ВЛ

желтая

pf-ad?

гк-448

л-1

к-3730 (Западный Китай)

ВЛ

желтая

s1

гк-136

л-1

к-6634 (Mermilloid, Чехословакия)

ВЛ

желтая

s1

гк-210

л-1

и-588294 (Б-125, Литва, ЛитНИИЗ)

ВЛ

красно-коричневая

гк-1631

л-2-1

к-726 (Солецкий кряж, Псковская губ.)

СЛ

красно-коричневая

гк-119

л-2-3

к-6210 (NP (RR) 38, Индия)

СЛ

красно-коричневая

гк-395

л-1

и-601680 (Walaga, Австралия)

НЛ

желтая

YSED1

гк-474

л-1

и-612949 (Amon, Чехия, Agritec)

НЛ

желтая

YSED1?2

гк-512

л-1

и-620803 (N852, неизвестно)

НЛ

желтая

sfbs1?, YSED1?

гк-513

л-2

и-620804 (N853, неизвестно)

НЛ

желтая

sfbs1?, YSED1?

гк-514

л-3

и-620805 (N854, неизвестно)

НЛ

желтая

sfbs1?, YSED1?

гк-515

л-4

и-620806 (N858, неизвестно)

НЛ

желтая

pf-ad?

гк-516

л-5

и-620807 (N864, неизвестно)

НЛ

желтая

sfbs1?, YSED1?

к-86771

сорт

Исток, Россия, Пензенский НИИСХ

НЛ

желтая

YSED1?

к-88711

сорт

ЛМ98, Россия, ВНИИЛ

НЛ

желтая

YSED1?

гк-390

л-1

и-595808 (Linola, Канада); НЛ

СЛ

желтая

YSED1

гк-393

л-2

ВЛ

красно-коричневая

 

гк-394

л-3

СЛ

красно-коричневая

 

гк-523

л-8-1

НЛ

желтая

YSED1

гк-391

л-1-2

и-601679 (Eyre, Австралия); НЛ

НЛ

желтая

sfbs1, YSED1

гк-472

л-3-1

ВЛ

желтая

YSED1

гк-498

л-3-2

ВЛ

желтая

YSED1

гк-441

л-4

НЛ

желтая

sfbs1, YSED1

гк-420

л-5

НЛ

желтая

sfbs1, YSED1

ВЛ-линии, присутствующие в родословной гибридов, использованных в исследовании

гк-65

л-3

к-3178 (местный, Тверская губ.)

ВЛ

крапчатая

ora1

гк-103

л-4

к-5896 (Lin 225, Нидерланды)

ВЛ

желтая

s1

гк-109

л-3–2

к-6099 (Makovi M.A.G., Аргентина)

ВЛ

красно-коричневая

wf1

гк-121

л-1–1

к-6272 (L. Dominion, Северная Ирландия)

ВЛ

светло-желто- коричневая

rs1

гк-173

л-1

и-548145 (48254, Ottawa 2152, Германия)

ВЛ

желтая

ysed2

гк-392

л-1

гк-132 (л-1 из к-6608, Currong, Австралия)

гк-103

ВЛ

желтая

 

Линии из гибридов от скрещивания линий, контрастных по уровню LIN

391 × 65-1

I43 л-1

гк-391

гк-65

ВЛ

желтая

ora1, sfbs1, YSED1

391 × 65-2

I4 л-2

СЛ

желтая

ora1, sfbs1, YSED1

391 × 109-1

I4 л-1

гк-109

НЛ

желтая

wf1, YSED1

391 × 109-2

I4 л-2

СЛ

желтая

wf1, YSED1

391 × 109-3

I4 л-3

СЛ

желтая

sfbs1, wf1, YSED1

391 × 109-4

I4 л-4

НЛ

желтая

sfbs1, wf1, YSED1

391 × 109-5

I4 л-5

ВЛ

желтая

sfbs1, wf1, YSED1

391 × 121-1

л-1

гк-121

ВЛ

светло-желто- коричневая

sfbs1, sfc1, rs1

391 × 121-2

л-2

СЛ

светло-желто- коричневая

sfbs1, sfc1, rs1

391 × 173-1

л-1

гк-173

ВЛ

желтая

sfbs1, sfc3-2, ysed2

391 × 173-2

л-2

ВЛ

желтая

sfbs1, sfc3-2, ysed2

391 × 392-1

л-1

гк-392

НЛ

желтая

s1, sfbs1, YSED1

Примечание. 1Образцы не участвуют в статистическом анализе; 2исходя из фенотипа линии, тест на аллелизм не проводили; 3поколение инбридинга для создающихся линий, где не отмечено 6 и более. LIN — линоленовая кислота. ВЛ — высоколиноленовый, СЛ — среднелиноленовый, НЛ — низколиноленовый.

Окончание табл. 1

 

По нескольку линий получено от каждого из двух НЛ-сортов — Linola и Eyre, они имеют различный габитус и отличаются по уровню линоленовой кислоты и соотношению ЖК. Часть линий получена в результате гибридизации НЛ-линии гк-391 (л-2-1 из и-601679, Eyre, Австралия), также гомозиготной по генам YSED1, sfbs1 (ингибирование синтеза антоцианов в гипокотиле и цветке) с ВЛ-линиями, несущими другие гены светлой окраски семян или гены хозяйственных признаков, и последующего отбора стабильных форм, но без контроля ЖКС. Среди ВЛ-родителей гк-65 (л-3 из к-3178, Тверская губерния) гомозиготна по гену ora1, скороспела, с ней созданы две линии (ВЛ и СЛ); гк-109 (л-3-2 из к-6099, Аргентина) гомозиготна по гену wf1 (белые лепестки), связанному с ранним цветением [17], с ней созданы пять линий (1 ВЛ, 2 СЛ, 2 НЛ); гк-121 (л-1-1 из к-6272, Северная Ирландия) гомозиготна по гену rs1, задействована в создании двух линий (ВЛ и СЛ); гк-173 гомозиготна по гену ysed2, с ее участием созданы две ВЛ-линии; гк-392 (гк-132 × гк-103) гомозиготна по генам s1 и sfbs1, из гибрида с ней отобрана НЛ-линия.

В 1995–2016 гг. на базе Пушкинских лабораторий ВИР линии оценивали по продолжительности фаз вегетационного периода (ВП): всходы — цветение первого цветка (T1), цветение первого цветка — созревание первой коробочки (T2); всходы — созревание первой коробочки (Т3), учитывали также общую (Ho) и техническую (Ht) высоту и длину соцветия (Inf). Так как погодные условия в годы изучения различались, данные выравнивали методом приведенного среднего [18] к раннеспелому стандарту. Затем для каждой линии вычисляли среднее значение за все время изучения.

ЖКС масла оценивали с помощью газожидкостной хроматографии с масспектрометрией метиловых эфиров ЖК на хроматографе Agilent 6850. Определяли процентный состав пяти ЖК в масле: PAL, STE, OLE, LIO, LIN, а также соотношение LIO/LIN.

Основной характеристикой технического масла является его йодное число (IOD). Это показатель ненасыщенности масла ЖК, чем он выше, тем быстрее масло высыхает.

IOD вычисляли по формуле (AOCS Method Cd 1c-85, цит. по [11]):

IOD = 0,86∙OLE + 1,732∙LIO + 2,616∙LIN,

где IOD — йодное число масла; OLE, LIO, LIN — доля олеиновой, линолевой и линоленовой кислот в масле соответственно.

Данные анализировали с помощью программ Statistica 7.0 for Windows и пакета анализа Excel 2007 for Windows [19, 20].

Интервал для минимального и максимального значений для каждого признака рассчитывали как min ± НСР (наименьшая существенная разница, по Фишеру) [21].

Для определения влияния группы льна по LIN (ВЛ, СЛ, НЛ) на высоту растения, скороспелость и ЖКС масла использовали однофакторный дисперсионный анализ (Analysis of Variation, ANOVA). Долю влияния фактора (η2, %) вычисляли по Фишеру [21].

Различия между группами льна по уровню LIN оценивали по критерию достоверной значимой разницы Тьюки (ДЗР, HSD — Honestly significant difference Tukey) для неравных выборок с апостериорным попарным сравнением средних после отклонения гипотезы Н0 об отсутствии различий по результатам ANOVA [19, 20].

Для каждой группы льна проводили анализ систем корреляций между признаками (по Пирсону) с построением корреляционных плеяд. Для оценки сходства систем связей вычисляли коэффициенты корреляции между z-преобразованными матрицами корреляций для каждой из трех групп. Эти показатели отображают сходство матриц по структуре [22].

Для каждой линии выделяли ДНК из 10 двухдневных корешков проростков льна по стандартной методике [23].

ПЦР проводили в объеме 20 мкл. В состав смеси входили: DreamTaq™ Green Master Mix (2X) (ThermoScientific), по 5 пикомолей каждого праймера и 1 мкл препарата ДНК. Праймеры синтезированы компанией «Евроген» [24]. Праймеры, фланкирующие участок с предположительной мутацией в гене LuFAD3A, подбирали с использованием программы idtdna.com [25]. Для выявления мутаций в гене LuFAD3B использовали опубликованные ранее праймеры и протокол [13].

Cеквенировали ДНК на базе РЦ СПбГУ «Развитие молекулярных и клеточных технологий» и компании «Евроген». В работе использовали референсные последовательности для гена LuFAD3A: HM991829.1, HM991830.1, HM991831.1, JQ963128.1.

Последовательности генов выравнивали с помощью программы tcoffee [26]. Нуклеотидные последовательности анализировали при помощи программ MEGA 7.0.21 [27] и UGENE1.290 [28].

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

С использованием шести поколений инцухта из 26 гетерогенных образцов льна получены 40 линий, среди которых 19 высоко-, 7 средне- и 14 низколиноленовых.

Признаки изученных линий варьировали слабо (CV < 10 %, T1, T3) или умеренно (CV < 26 %, Ho, Ht, Inf, T2, PAL, STE, OLE, IOD), и только те из них, которые были связаны с синтезом линоленовой кислоты (CV = 26–146 %, LIO, LIN, LIO/LIN), были сильно варьирующими (табл. 2).

 

Таблица 2

Параметры высоты растения, продолжительность фаз вегетационного периода и жирнокислотного состава масла семян у образцов льна, различающихся по уровню синтеза линоленовой кислоты

Номер каталога ВИР

Ho

Ht

Inf

T1

T2

T3

PAL

STE

OLE

LIO

LIN

LIO/ LIN

IOD

Линии с высоким содержанием линоленовой кислоты

гк-2

93

75

18

40

25

64

4

3

19

15

60

0,25

198

гк-65

70

52

17

39

26

65

4

3

21

17

55

0,30

192

гк-483

59

33

25

47

38

85

6

3

13

11

67

0,17

205

гк-448

64

42

22

40

41

81

6

2

14

12

67

0,17

209

гк-103

75

62

13

49

36

85

5

4

14

12

65

0,19

203

гк-109

75

49

26

43

40

82

4

3

23

15

55

0,27

190

гк-121

62

48

14

43

33

76

5

3

16

18

59

0,30

198

гк-136

72

59

14

47

36

84

5

5

15

14

62

0,22

198

гк-173

78

52

26

45

38

83

5

5

18

20

53

0,37

187

гк-210

84

63

20

43

32

75

5

5

23

19

48

0,40

180

гк-393

79

60

19

55

48

103

6

3

21

13

57

0,22

189

гк-472

57

38

20

45

41

85

7

5

15

20

52

0,39

185

гк-498

56

37

19

45

41

86

3

2

13

20

61

0,33

206

гк-392

63

41

22

42

38

80

5

5

20

15

54

0,28

186

391 × 65-1

74

57

17

53

28

81

6

3

23

16

51

0,31

183

391 109-5

64

47

18

41

34

75

5

3

27

17

49

0,34

179

391 121-1

68

53

15

46

36

82

5

4

25

21

46

0,45

177

391 173-1

64

44

20

46

40

86

4

2

9

18

66

0,27

212

391 173-2

72

50

22

48

40

88

6

5

17

19

53

0,35

187

Среднее

70 ± 2

51 ± 2

19 ± 1

45 ± 1

36 ± 1

81 ± 2

5 ± 0

4 ± 0

18 ± 1

16 ± 1

57 ± 1

0,29 ± 0,02

193 ± 2

CV

14

21

21

10

16

10

19

29

26

19

11

27

6

Линии с пониженным содержанием линоленовой кислоты

гк-163

      

7

3

28

19

43

0,44

169

гк-119

59

36

22

41

36

77

5

4

34

17

39

0,44

161

гк-390

74

55

19

47

31

78

5

3

17

32

44

0,72

184

гк-394

80

59

21

48

32

80

5

4

20

37

34

1,08

170

391 65-2

76

60

16

54

27

81

6

4

19

35

36

0,96

171

391 109-2

64

46

17

41

34

75

5

4

29

48

14

3,46

144

391 109-3

60

45

15

45

34

78

5

4

25

29

37

0,78

168

391 121-2

67

46

20

45

38

83

5

5

29

21

41

0,51

167

Среднее

68 ± 3

50 ± 3

19 ± 1

46 ± 2

33 ± 1

79 ± 1

5 ± 0

4 ± 0

25 ± 2

31 ± 4

35 ± 4

1,14 ± 0,40

166 ± 5

CV

12

18

15

10

10

3

8

15

26

33

28

92

7

Низколиноленовые линии и сорта

гк-523

74

48

25

49

32

81

6

4

17

67

6

12,00

146

гк-391

53

35

18

42

42

85

6

4

23

60

7

9,07

142

гк-441

59

42

17

41

44

85

7

3

27

62

2

29,27

135

гк-420

56

37

19

42

41

83

7

4

18

69

3

22,78

142

гк-395

58

38

20

45

40

85

7

3

19

69

2

31,26

141

гк-474

74

52

22

53

41

94

7

4

16

72

1

49,33

142

гк-512

52

37

15

43

41

84

7

5

24

61

3

23,51

134

гк-513

57

38

18

43

40

82

7

6

27

58

2

31,99

129

гк-514

55

38

17

43

40

84

7

4

19

69

2

34,74

140

гк-515

62

40

22

48

38

86

6

4

18

68

3

26,07

141

гк-516

52

37

15

43

39

82

6

4

22

66

2

37,31

138

391 109-1

58

42

16

41

33

74

6

4

26

62

1

42,66

135

391 109-4

64

45

19

42

34

76

4

4

24

62

6

10,18

145

391 392-1

61

40

21

43

39

82

3

2

16

75

4

19,60

154

к-8677

      

6

4

13

75

2

47,18

145

к-8871

      

7

3

19

69

2

33,84

141

Среднее

60 ± 2

41 ± 1

19 ± 1

44 ± 1

39 ± 1

83 ± 1

6 ± 0

4 ± 0

21 ± 1

66 ± 1

3 ± 0

27 ± 3

140 ± 2

CV

12

12

16

8

9

6

19

24

20

8

57

44

4

Все среднее

66 ± 2

47 ± 2

19 ± 1

45 ± 1

37 ± 1

82 ± 1

5 ± 0

4 ± 0

20 ± 1

36 ± 4

34 ± 4

10 ± 2

170 ± 4

НСР

3

3

1

1

2

2

0,3

0,3

2

7

8

5

8

CV

15

20

18

9

14

8

20

25

26

64

74

149

15

Примечание. Ho — общая высота соцветия; Ht — техническая высота соцветия; Inf — длина соцветия; T1 — продолжительность фазы всходы–цветение первого цветка; T2 — продолжительность фазы цветение первого цветка–созревание первой коробочки; Т3 — продолжительность фазы всходы–созревание первой коробочки; PAL — пальмитиновая кислота; STE — стеариновая кислота; OLE — олеиновая кислота; LIO — линолевая кислота; LIN — линоленовая кислота; IOD — йодное число. Курсивом обозначены минимальные, а полужирным шрифтом — максимальные значения выделившиеся по критерию Тьюки для всей выборки. Гк-390 не участвует в дисперсионном анализе высоколиноленовых образцов.

Окончание табл. 2

 

Общая высота растения была от 52 см у некоторых НЛ-линий (гк-391, -512, -514, -516) до 95 см у гк-2 (стандарта), техническая длина — от 33 см (ВЛ гк-483; СЛ гк-119; НЛ гк-391) до 75 см (гк-2). ANOVA показал достоверные различия групп льна по всем трем признакам. Различия в 10 см по ним между ВЛ и НЛ по критерию Тьюки были достоверны. Длина соцветия колебалась от 13 см (ВЛ гк-103, -121, -136) до 26 см (ВЛ гк-483, -109, -173; НЛ гк-523) и практически не различалась между группами льна (см. табл. 2, рис. 2).

 

Рис. 2. Доля влияния (η2) степени линоленовости (ВЛ — высоколиноленовый, СЛ — среднелиноленовый, НЛ — низколиноленовый) и случайного варьирования по результатам однофакторного дисперсионного анализа (ANOVA). *различия между группами достоверны; Ho — общая высота соцветия; Ht — техническая высота соцветия; Inf — длина соцветия; T1 — продолжительность фазы всходы–цветение первого цветка; T2 — продолжительность фазы цветение первого цветка–созревание первой коробочки; Т3 — продолжительность фазы всходы–созревание первой коробочки; PAL — пальмитиновая кислота; STE — стеариновая кислота; OLE — олеиновая кислота; LIO — линолевая кислота; LIN — линоленовая кислота; IOD — йодное число; F — значение критерия Фишера; p — вероятность сходства классов (ВЛ, СЛ, НЛ); различия — достоверные различия этих классов по результатам апостериорного сравнения по критерию Тьюки для неравных выборок

 

Самые скороспелые ВЛ-линии гк-2 и гк-65, у которых все три периода вегетации были короткими (T1 = 39, T2 = 25, T3 = 64 сут), а позднеспелая — ВЛ гк-393, мутант из НЛ-линий сорта Linola (T1 = 55, T2 = 48, T3 = 103 сут). Только по продолжительности периода всходы — цветение выделялись ВЛ гк-448 (40 сут) и СЛ л-2 из гк-391 × гк-65 (54 сут). По результатам ANOVA не было выявлено различий между группами льна по T1 и T3, но обнаружены достоверные отличия по T2. Однако максимальные различия в 6 сут между группами льна для T2 по критерию Тьюки были недостоверны (см. табл. 2, рис. 2).

Содержание PAL в масле колебалось от 3 % (ВЛ гк-2, -65, -498, л-1 из гк-391 × гк-173; НЛ л-1 из гк-391 × гк-392) до 7 % (ВЛ гк-472; СЛ гк-163; НЛ гк-441, -420, -395, -474, -512, -513, -514, к-8871). ANOVA показал достоверные различия для групп льна по этому признаку. Различия в 1 % между ВЛ и НЛ по критерию Тьюки были достоверны, а из-за небольшой выборки те же различия между ВЛ и СЛ выявлены не были (см. табл. 2, рис. 2).

Содержание STE в масле колебалось от 2 % (ВЛ гк-498, л-1 из гк-391 × гк-173; НЛ л-1 из гк-391 × гк-392) до 6 % (НЛ гк-513) и достоверно не различалось у групп льна (см. табл. 2, рис. 2).

Содержание OLE в масле колебалось от 9 % (ВЛ л-1 из гк-391 × гк-173) до 34 % (СЛ гк-119). ANOVA продемонстрировал достоверные различия для групп льна по этому признаку, обусловленные разницей в 7 % между СЛ и ВЛ, достоверной по критерию Тьюки (см. табл. 2, рис. 2).

Доля влияния группы льна (η2) на описанные выше признаки при достоверных различиях составляла от 17 до 25 %. Для групп льна по всем признакам, связанным с уровнем LIN, ANOVA показал достоверные различия, доля влияния составляла от 77 до 95 %, что было вызвано принципом разделения на группы (см. рис. 2).

Содержание LIO в масле колебалось от 11 до 75 % (у ВЛ 11–21 %, у СЛ 17–48 %, у НЛ 58–75 %). Наименьший процент LIO имели почти все ВЛ-линии (гк-483, -448, -103 и др.), а наибольший — почти все НЛ (л-1 из гк-391 × гк-392, к-8677, гк-474 и др.) (см. табл. 2). Критерий Тьюки показал достоверные различия для всех трех групп льна.

Содержание LIN в масле колебалось от 1 до 67 % (у ВЛ 46–67 %, у СЛ 14–44 %, у НЛ 1–7 %). Наименьший процент LIN имели все НЛ-образцы, а наибольший — ВЛ гк-483, -448 и др. (см. табл. 2). Критерий Тьюки указывал на достоверные различия для всех трех групп льна (см. рис. 2).

Соотношение LIO/LIN колебалось от 0,17 до 49,33 (у ВЛ 0,17–0,45, у СЛ 0,44–3,46, у НЛ 9,07–49,33). Минимальные значения имели все ВЛ-льны, а максимальное — НЛ. LIO/LIN — очень сильно варьирующий признак (CV = 149). Однако у ВЛ-форм он был более постоянен (CV = 27 %), чем у СЛ (CV = 92 %) и НЛ (CV = 44 %). ANOVA продемонстрировал достоверные различия для групп льна по этому признаку (см. табл. 2), но по критерию Тьюки достоверно отличались только НЛ- от ВЛ- и СЛ-форм (см. рис. 2).

Из всех изученных образцов «в чистом виде» для лечебного питания может быть использовано масло лишь л-2 из гк-391 × гк-109, а при диетическом — двух линий из коммерческих сортов гк-391 и гк-523, а также линии гибридного происхождения л-4 из гк-391 × гк-109. Остальным маслам необходим купаж.

Йодное число масла колебалось от 129 до 212 (у ВЛ 177–212, у СЛ 161–184, у НЛ 129–154). Наименьшим оно было у НЛ гк-441, -512, -513, л-1 из гк-391 × гк-109, наибольшим — у ВЛ гк-483, -448, -472, л-1 из гк-391 × гк-121 (см. табл. 2). Критерий Тьюки показал достоверные различия для всех трех групп льна (см. табл. 2, рис. 2).

Содержание ЖК в семенах иногда коррелируют с фазами ВП и высотами. Как мы и предполагали ранее [10], изменения, происходящие в семенах при снижении синтеза LIN, вызывают несимметричные изменения в соотношении ЖК, что сказывается на корреляциях между ними. Во всех трех группах льна было выявлено две плеяды скоррелированных признаков. И только несколько корреляций совпало в каждой из них: в первой — высоты тесно связаны друг с другом, так как Ht составляет около 90 % от Ho; в центре второй — содержание LIN в масле, отрицательно коррелирующее с соотношением LIO/LIN и положительно с IOD. Как и в первом случае, это следствие арифметических закономерностей вычисления последних двух признаков (рис. 3).

 

Рис. 3. Корреляционные плеяды признаков высоты растения, продолжительности фаз вегетационного периода и жирнокислотного состава масла семян у образцов льна, различающихся по уровню синтеза линоленовой кислоты: а — высоколиноленовые; б — среднелиноленовые; в — низколиноленовые. Ho — общая высота соцветия; Ht — техническая высота соцветия; Inf — длина соцветия; T1 — продолжительность фазы всходы–цветение первого цветка; T2 — продолжительность фазы цветение первого цветка–созревание первой коробочки; Т3 — продолжительность фазы всходы–созревание первой коробочки; PAL — пальмитиновая кислота; STE — стеариновая кислота; OLE — олеиновая кислота; LIO — линолевая кислота; LIN — линоленовая кислота; IOD — йодное число

 

У ВЛ-линий первую плеяду образуют длительность вегетационного периода (T3), тесно положительно связанная с ее фазами — T1 и T2, а также умеренно положительно — с PAL, образующейся в начале биосинтеза ЖК. T2 отрицательно коррелирует с Ht, которая в свою очередь очень сильно положительно связана с Ho. Вторую плеяду, помимо очень сильной положительной корреляции LIN с IOD и сильной отрицательной с LIO/LIN, а также сильной отрицательной между последними, дополняет сильная отрицательная корреляция OLE с LIN и IOD, а также умеренная отрицательная последних со STE. LIO очень сильно положительно связана с LIO/LIN и умеренно отрицательно с LIN. Негативно коррелирующие с LIN ЖК являются ее предшественниками. Inf независима от других признаков (см. рис. 3).

Группа СЛ-линий малочисленна, корреляции между ее признаками достоверны при r > 0,75, и многие сильные и все умеренные корреляции не могут быть приняты во внимание. Здесь первую плеяду помимо высот образует T1, сильно положительно связанная с Ht, и обе они отрицательно коррелируют с T2. С первыми двумя признаками сильно отрицательно коррелирует содержание OLE. Вторую плеяду образуют попарно положительно сильно коррелирующие между собой LIO и IOD, а также LIO и соотношение LIO/LIN. Эти две группы отрицательно коррелируют друг с другом. Inf, T3, содержание насыщенных кислот не зависят от других признаков (см. рис. 3).

У НЛ-линий первую плеяду вместе с высотами образуют T1 и Inf, положительно связанные друг с другом. С T1 положительно коррелирует T3, а с ней положительно связана T2. Центр второй плеяды смещается на IOD, которое положительно связано с LIO (сильно) и LIN (умеренно) и отрицательно с OLE, STE и PAL. LIO также очень сильно отрицательно коррелирует с OLE и умеренно со STE, последняя в свою очередь положительно связана с PAL. LIN очень сильно отрицательно коррелирует с LIO/LIN, так как именно изменчивостью LIN в основном определяется варьирование этого соотношения. Плеяды связаны между собой умеренными отрицательными корреляциями OLE с T1 и Inf, а также положительной корреляцией последней с IOD (см. рис. 3).

Корреляции между z-преобразованными матрицами корреляций для групп льна показали их умеренное сходство (rВЛ-СЛ = 0,50, rВЛ-НЛ = 0,42, rСЛ-НЛ = 0,54), которое в основном обусловлено арифметическими закономерностями измерения/вычисления признаков.

При помощи факторного анализа (метод главных компонент) было выявлено два основных фактора, влияющих на исследуемые признаки (рис. 4).

 

Рис. 4. Распределение 13 изученных признаков (а) и 40 линий льна (б) в системе двух факторов. Ho — общая высота соцветия; Ht — техническая высота соцветия; Inf — длина соцветия; T1 — продолжительность фазы всходы–цветение первого цветка; T2 — продолжительность фазы цветение первого цветка–созревание первой коробочки; Т3 — продолжительность фазы всходы–созревание первой коробочки; PAL — пальмитиновая кислота; STE — стеариновая кислота; OLE — олеиновая кислота; LIO — линолевая кислота; LIN — линоленовая кислота; IOD — йодное число

 

Первый фактор определяет соотношение LIO и LIN. Он указывает на антагонизм LIN, IOD и высот растения (Ho, Ht), с одной стороны, и LIO, PAL, LIO/LIN — с другой, и характеризует около 40 % общей изменчивости.

Этот фактор с небольшим захождением отделил НЛ-линии от ВЛ. СЛ-линии заняли промежуточное положение. Интересно, что «захождение» в сторону НЛ вызвано наличием СЛ-гетерозиготы в выборке (л-2 из гк-391 × гк-109), а также ревертанта к ВЛ из НЛ-сорта (гк-472).

Второй фактор определяет скороспелость и показывает антагонизм длительности всех трех фаз ВП, с одной стороны, и OLE — с другой. Он объясняет около 20 % общей изменчивости.

Этот фактор выделил раннеспелые, как правило, высокоолеиновые гк-2, -65 и л-1, -2, -4, -5 из гк-391 × гк-109, и экстремально позднеспелую гк-393, а также позднеспелые низкоолеиновые -483, -472, л-1 и -2 из гк-391 × 173.

В системе двух факторов выделяют три группы линий: 1) НЛ гк-391, -441, -420, -395, -512, -513, -514, -515, -516 — с наименьшим количеством LIN и наибольшим LIO; 2) наиболее скороспелые и высоколиноленовые гк-2 и -65; 3) родственные НЛ л-2 и СЛ л-4 из гк-391 × гк-109 как скороспелые. Отдельно от других находятся экстремально позднеспелая ВЛ гк-393 и позднеспелая гк-474 — НЛ и низкоолеиновая.

Таким образом, факторный анализ позволил сгруппировать линии по скоррелированным признакам и комплексно охарактеризовать их.

Для поиска различий линий НЛ и СЛ по генам биосинтеза линоленовой кислоты разработан новый метод идентификации аллели гена LuFAD3A, контролирующего ее образование. Анализ имеющихся в базе данных NCBI-последовательностей аллелей гена LuFAD3A показал, что в большинстве НЛ-сортов мутация, ингибирующая синтез LIN, находится в первом экзоне этого гена. Были сконструированы праймеры FAD3Ae1F (acttggcatcctgcattactt) и FAD3Ae1R (ccagaaagataatgtgaaattacc), фланкирующие этот участок. Продукт амплификации имеет длину 526 п. н. При его секвенировании у каждой из мутантных аллелей LuFAD3A линий гк-391 и гк-515 обнаружены одинаковые замены в положениях 28 (G → A), 255 (G → A) и 309 (A → G) первого экзона, что говорит об идентичности аллелей между собой и полном сходстве с последовательностью из NCBI для генотипа SP2047 (HM881831). Замена в положении 255 (G → A) приводит к образованию стоп-кодона.

Использование рестриктазы HaeIII позволяет идентифицировать мутантную аллель, содержащую замену G255 → A255. В пределах амплифицированного фрагмента аллели дикого типа присутствует два сайта рестрикции (рис. 5). При его расщеплении образуются фрагменты 85, 90 и 351 п. н. Указанная выше мутация находится в положении 442 продукта амплификации и затрагивает один из двух сайтов рестрикции, в результате чего образуются фрагменты 90 и 436 (351 + 85) п. н. Таким образом, нами предложен новый вариант CAPS-маркера. С его помощью установлено, что сорта ЛМ98 и Исток, а также линии из НЛ-сортов Linola (гк-390, -523), Eyre (гк-391, -441, -420), Walaga (гк-395), Amon (гк-474) и образцов 852, 853, 854, 858, 864 (гк-512–гк-516) гомозиготны по мутации в этом участке гена (табл. 3).

 

Рис. 5. Молекулярное маркирование генов LuFAD3A (а–в) и LuFAD3B (г–е): а, г — рестрикционная карта фрагмента гена; в, д — хроматограммы дикого типа (гк-2) и мутанта (гк-391), SNP отмечены стрелками; в, е — электрофореграмма продуктов рестрикции ПЦР-фрагментов. ВЛ — высоколиноленовый, СЛ — среднелиноленовый, НЛ — низколиноленовый

 

Таблица 3

Полиморфизм линий льна по длине рестрикционных фрагментов (CAPS-маркеров) для гена LuFAD3A

Номер каталога ВИР

LIN, %

Длина фрагмента (п. н.)

Аллель

Номер каталога ВИР

LIN, %

Длина фрагмента (п. н.)

Аллель

1

2

1

2

Высоколиноленовые линии

Среднелиноленовые линии

гк-2

58

330

100

д. т.

гк-163

43

330

100

д. т.

гк-65

50

330

100

д. т.

гк-119

33

330

100

д. т.

гк-483

66

330

100

д. т.

гк-390

41

430

100

мут.

гк-448

67

330

100

д. т.

гк-394

34

330

100

д. т.

гк-103

61

330

100

д. т.

391 × 65-2

36

430

100

мут.

гк-109

46

330

100

д. т.

391 × 109-2

14

430+330

100

д. т. + мут.

гк-121

58

330

100

д. т.

391 × 109-3

37

430

100

мут.

гк-136

61

330

100

д. т.

391 × 121-2

41

330

100

д. т.

гк-173

55

330

100

д. т.

Низколиноленовые линии

гк-210

48

330

100

д. т.

гк-523

6

430

100

мут.

гк-393

57

330

100

д. т.

гк-391

5

430

100

мут.

гк-472

52

330

100

д. т.

гк-441

2

430

100

мут.

гк-498

61

330

100

д. т.

гк-420

3

430

100

мут.

гк-392

54

330

100

д. т.

гк-395

2

430

100

мут.

391 × 65-1

51

330

100

д. т.

гк-474

2

430

100

мут.

391 × 109-5

49

330

100

д. т.

гк-512

3

430

100

мут.

391 × 121-1

46

430

100

мут.

гк-513

2

430

100

мут.

391 × 173-1

66

330

100

д. т.

гк-514

2

430

100

мут.

391 × 173-2

53

330

100

д. т.

гк-515

3

430

100

мут.

     

гк-516

2

430

100

мут.

     

391 × 109-1

1

430

100

мут.

     

391 × 109-4

6

430

100

мут.

     

391 × 392-1

4

430

100

мут.

     

к-8677

2

430

100

мут.

     

к-8871

2

430

100

мут.

 

Для второго гена LuFAD3B был использован опубликованный ранее протокол для обнаружения мутации в первом экзоне [13]. Продукт амплификации имеет длину 468 п. н. При его секвенировании у мутантных аллелей линий гк-391 и гк-515 обнаружена замена в положении 6 (С → T) второго экзона, приводящая к замене Hys → Tyr. Показано, что использование рестриктазы BsaJ1 позволяет идентифицировать мутантную аллель. В пределах амплифицированного фрагмента аллели дикого типа присутствует два сайта для рестриктазы (рис. 5). При его расщеплении образуются фрагменты длиной 191, 240 и 37 п. н. Указанная выше мутация находится в положении 431 продукта амплификации и затрагивает один из трех сайтов рестрикции, в результате чего образуются фрагменты длиной 191 и 277 (240 + 37) п. н. Так как продукт рестрикции 37 п. н. ВЛ-форм сливается с низкомолекулярными неспецифическими продуктами амплификации, создается ложное впечатление о различии ВЛ- и НЛ-форм по размеру большего продукта амплификации. Таким образом, CAPS-маркер, предложенный ранее для генотипа 593–708, может быть использован и для гк-391. С его помощью выяснено, что линии из НЛ-сортов Linola (гк-394), Eyre (гк-391, 420), Walaga (гк-395) и образца 858 (гк-515) гомозиготны по мутации в этом участке гена (табл. 4). На основе имеющихся в базе данных NCBI-последовательностей аллели гена LuFAD3B (KF026416) установлено, что сорт Amon имеет ту же точковую мутацию, что и гк-391.

 

Таблица 4

Полиморфизм линий льна по длине рестрикционных фрагментов (CAPS-маркеров) для гена LuFAD3B

Номер каталога ВИР

LIN, %

Длина фрагмента (п. н.)

Аллель

Номер каталога ВИР

LIN, %

Длина фрагмента (п. н.)

Аллель

1

2

1

2

Высоколиноленовые линии

Среднелиноленовые линии

гк-2

58

240

191

д. т.

гк-119

33

240

191

д. т.

гк-65

50

240

191

д. т.

гк-390

41

240

191

д. т.

гк-109

46

240

191

д. т.

гк-394

34

277

191

мут.

гк-136

61

240

191

д. т.

Низколиноленовые линии

гк-173

55

240

191

д. т.

гк-391

5

277

191

мут.

гк-393

57

240

191

д. т.

гк-420

3

277

191

мут.

     

гк-395

2

277

191

мут.

     

гк-515

3

277

191

мут.

 

Одним из первых в ВИР поступил НЛ-сорт Eyre (Австралия), который был гетерогенен по генам НЛ. На его основе было получено несколько линий, но используется в гибридизации только одна (гк-391). С помощью полученных маркеров была подтверждена гомозиготность гибридов от скрещивания НЛ- (гк-391) и ВЛ-линий (см. табл. 3, рис. 5) по гену LuFAD3A. Гибриды F7 от скрещивания гк-391 × гк-109 (л-1, -3, -4), гк-391 × гк-65 (л-2) и F9 от скрещивания гк-391 × гк-392 (л-1) гомозиготны по рецессивной аллели гена LuFAD3A. Гибриды F9 гк-391 × гк-121 (л-1, 2), гк-391 × гк-121 (л-1) и F7 гк-391 × гк-65 (л-1), гк-391 × гк-109 (л-5) гомозиготны по доминантной аллели этого гена. Гибрид F7 л-2 (гк-391 × гк-109) оказался гетерозиготен по этому гену. Интересна линия л-2 из гк-391 × гк-121: по результатам анализа ДНК она гомозиготна по рецессивной аллели гена НЛ, но имеет пограничное содержание линоленовой кислоты, поэтому была отнесена нами к ВЛ, а не к СЛ. Таким образом, у родительской линии гк-121 существует какой-то другой способ незначительно повысить уровень линоленовой кислоты. Хотя в литературе описаны только два гена, отвечающие за синтез LIN, по нашим данным, генетическое окружение не менее важно.

НЛ-сорта, находящиеся в нашем распоряжении, позднеспелые и не адаптированы к условиям России, поэтому в задачу исследования входил отбор перспективных раннеспелых форм. Было показано, что гибриды, в родословной которых была линия гк-109, созревали на 8–10 дней раньше родительской НЛ-линии гк-391. Наиболее перспективны СЛ-линии л-3 и НЛ-линии л-1 и л-4 от скрещивания гк-391 × гк-109.

ЗАКЛЮЧЕНИЕ

Линии генколлекции льна ВИР обладают широким разнообразием ЖКС масла. Резкое снижение синтеза линоленовой кислоты вызывает несимметричные изменения в соотношении ЖК, что сказывается на корреляциях между ними и другими признаками. Факторный анализ четко разделил линии по уровню линоленовой кислоты и связанных с ним признакам. Были сконструированы праймеры, подобраны рестриктазы и разработан протокол эксперимента для идентификации аллелей гена LuFAD3A. Установлено, что все имеющиеся в коллекции ВИР НЛ-формы несут мутацию в первом экзоне (G255 × A255) этого гена. Тест-система [13], разработанная для идентификации мутации в первом экзоне гена LuFAD3B генотипа 593–708, может быть использована и для мутации во втором экзоне у гк-391 и др.

Четырех поколений инбридинга в большинстве случаев достаточно для отбора гомозиготных форм.

Благодарности

Работа выполнена при финансовой поддержке программы ВИР № 0662-2018-0005 АААА-А16-116040710366-3 «Идентификация и картирование генофонда важнейших сельскохозяйственных культур, формирование генетических коллекций с ценными для селекции аллелями генов и локусами количественных признаков».

Авторы благодарят РЦ СПбГУ «Развитие молекулярных и клеточных технологий» и лично Е.Ю. Городилову и А.Э. Машарского за содействие в проведении секвенирования ДНК.

Elizaveta A. Porokhovinova

Federal Research Centre N.I. Vavilov All-Russian Institute of Plant Genetic Resources (VIR)

Author for correspondence.
Email: e.porohovinova@mail.ru
ORCID iD: 0000-0002-8328-9684
SPIN-code: 5033-3263
Scopus Author ID: 22986519000
ResearcherId: S-6756-2016

Russian Federation, 42,44, B. Morskaya Street, St. Petersburg, 190000

PhD, Senior Researcher, Oil and Fibre Crops Department

Tatyana V. Shelenga

Federal Research Centre N.I. Vavilov All-Russian Institute of Plant Genetic Resources (VIR)

Email: tatianashelenga@yandex.ru
Scopus Author ID: 37069721500

Russian Federation, 42,44, B. Morskaya Street, St. Petersburg, 190000

PhD, Leader Researcher, Department of Biochemistry and Molecular Biology

Tatyana V. Matveeva

Saint Petersburg State University

Email: radishlet@gmail.com
ORCID iD: 0000-0001-8569-6665
SPIN-code: 3877-6598
Scopus Author ID: 7006494611
ResearcherId: J-6000-2013

Russian Federation, 199034 , St. Petersburg, Universitetskaya Emb, 7/9  

Doctor of science, Professor, Chair of Genetics and Biotechnology

Andrey V. Pavlov

Federal Research Centre N.I. Vavilov All-Russian Institute of Plant Genetic Resources (VIR)

Email: avpavlov77@yandex.ru
Scopus Author ID: 22986534600

Russian Federation, 42,44, B. Morskaya Street, St. Petersburg, 190000

PhD, Senior Researcher, Oil and Fibre Crops Department

Elizaveta A. Grigorieva

Federal Research Centre N.I. Vavilov All-Russian Institute of Plant Genetic Resources (VIR)

Email: e.grigoreva@vir.nw.ru

Russian Federation, 42,44, B. Morskaya Street, St. Petersburg, 190000

Master Student, Laboratory of Monitoring Genetic Erosion

Nina B. Brutch

Federal Research Centre N.I. Vavilov All-Russian Institute of Plant Genetic Resources (VIR)

Email: n.brutch@vir.nw.ru
SPIN-code: 1753-4382
Scopus Author ID: 26665888600

Russian Federation, 42,44, B. Morskaya Street, St. Petersburg, 190000

Doctor of Science, Main Researcher, Oil and Fibre Crops Department

  1. Viju C, Yeung MT, Kerr WA. Post-moratorium EU regulation of genetically modified products: triffid flax. CATPRN Commissioned Paper. 2011;(3):1-30.
  2. ФАОСТАТ. Сельскохозяйственные культуры: “crops processed”, element: “Area harvested”, “Yield” crops: linseed, flax [cited 2017 Dec 15]. Available from: http://www.fao.org/faostat/ru/#data/QC. Ссылка активна на 15.12.2017.
  3. Лукомец В.М., Зеленцов С.В., Кривошлыков К.М. Перспективы и резервы расширения производства масличных культур в Российской Федерации // Масличные культуры. Научно-технический бюллетень ВНИИМК. – 2015. – № 4. – С. 81–102. [Lukomets VM, Zelentsov SV, Krivoshlykov KM. Outlook and reserves the expansion of oil crops production in the Russian Federation. Oil crops. Scientific and Technical Bulletin VNIIMK. 2015;(4):81-102. (In Russ.)]
  4. Кутузова С.Н. Лен // Генетика культурных растений. – СПб.: ВИР, 1998. – C. 6–52. [Kutuzova SN. Len. In: Genetika kul'turnykh rastenii. St. Petersburg: VIR; 1998. P. 6-52. (In Russ.)]
  5. Сорта растений, включенные в Государственный реестр селекционных достижений, допущенных к использованию Сорта культуры «Лен-долгунец». [Sorta rasteniy, vklyuchennye v Gosudarstvennyy reestr selektsionnykh dostizheniy, dopushchennykh k ispol'zovaniyu Sorta kul'tury “Len-dolgunets” (In Russ.)]. Доступно по: http://reestr.gossort.com/reestr/ culture/133. Ссылка активна на 28.01.2018.
  6. Рожмина Т.А., Лошакова Н.И. Образцы прядильного и масличного льна (Linum usitatissimum L.) — источники эффективных генов устойчивости к фузариозному увяданию и ее зависимость от температуры // Сельскохозяйственная биология. – 2016. – Т. 51. – № 3. – С. 310–317. [Rozhmina TA, Loshakova NI. New sources of effective resistance genes to fusarium wilt in flax (Linum usitatissimum L.) depending on temperature. Agricultural biology. 2016;51(3):310-317. (In Russ.)]
  7. Каталог мировой коллекции ВИР. Лен (характеристика образцов по биохимическим показателям). – Вып. 775. – СПб.: ВИР; 2006. – 80 с. [Katalog mirovoi kollektsii VIR. Len (kharakteristika obraztsov po biokhimicheskim pokazatelyam). Issue 775. Saint Petersburg: VIR; 2006. 80 p. (In Russ.)]
  8. Тутельян В.А., Батурин А.К., Гаппаров М.Г., и др. Рациональное питание, нормы физиологических потребностей в энергии и пищевых веществах для различных групп населения Российской Федерации: Методические рекомендации. – М., 2008. – 39 с. [Tutel'yan VA, Baturin AK, Gapparov MG, et al. Ratsional'noye pitaniye, normy fiziologicheskikh potrebnostei v energii i pishchevykh veshchestvakh dlya razlichnykh grupp naseleniya Rossiiskoi Federatsii. Metodicheskiye rekomendatsii. Moscow; 2008. 39 p. (In Russ.)]
  9. Green AG. Genetic control of polyunsaturated fatty acid biosynthesis in flax (Linum usitatissimum) seed oil. Theor Appl Genet. 1986;72(5):654-661. https://doi.org/10.1007/BF00289004.
  10. Porokhovinova E, Shelenga T, Kosykh L, et al. Biochemical diversity of fatty acid composition in flax from VIR’s genetic collection and effect of environment on its development. Russ J Genet Appl Res. 2017;7(6):626-639. https://doi.org/10.1134/S2079059717060107.
  11. Thambugala D, Duguid S, Loewen E, et al. Genetic variation of six desaturase genes in flax and their impact on fatty acid composition. Theor Appl Genet. 2013;126(10):2627-2641. https://doi.org/10.1007/s00122-013-2161-2.
  12. Krasowska A, Dziadkowiec D, Polinceusz A, et al. Cloning of flax oleic fatty acid desaturase and its expression in yeast. J Am Oil Chem Soc. 2007;84(9):809-816. https://doi.org/10.1007/s11746-007-1106-9.
  13. Vrinten P, Hu Z, Munchinsky MA, et al. Two FAD3 desaturase genes control the level of linolenic acid in flax seed. Plant Physiol. 2005;139(1):79-87. https://doi.org/10.1104/pp.105.064451.
  14. Fofana B, Duguid S, Cloutier S. Cloning of fatty acid biosynthetic genes – ketoacyl CoA synthase, fatty acid elongase, stearoyl-ACP desaturase, and fatty acid desaturase and analysis of expression in the early developmental stages of flax (Linum usitatissimum L.) seeds. Plant Sci. 2004;166(6):1487-1496. https://doi.org/10.1016/j.plantsci.2004.01.025.
  15. You FM, Li P, Kumar S, et al. Genome-wide identification and characterization of the gene families controlling fatty acid biosynthesis in flax (Linum usitatissimum L.). J Proteomics Bioinform. 2014;7(10):310-326. https://doi.org/10.4172/jpb.1000334.
  16. Пороховинова Е.А. Генетический контроль морфологических признаков проростков, плода и семян у льна (Linum usitatissimum) // Вавиловский журнал генетики и селекции. – 2012. – Т. 16. – № 4–2. – С. 936–947. [Porokhovinova EA. Genetic control of morphological characters of seedlings, bolls, and seed in flax (Linum usitatissimum). Vavilov journal of genetics and breeding. 2012;16(4-2):936-947. (In Russ.)]
  17. Пороховинова Е.А. Изучение наследования окраски и формы цветка и семян, а также ее связи с продолжительностью фазы всходы — цветение у льна (Linum usitatissimum L.) // Научно-технический бюллетень ВНИИР им. Н.И. Вавилова. – 2000. – № 239. – С. 56–58. [Porokhovinova EA. Izuchenie nasledovaniya okraski i formy tsvetka i semyan, a takzhe ee svyazi s prodolzhitel'nost'yu fazy vskhody-tsvetenie u l'na (Linum usitatissimum L.). Nauchno-tekhnicheskiy byulleten' VNIIR im. N.I. Vavilova. 2000;(239):56-58. (In Russ.)]
  18. Брач Н.Б., Пороховинова Е.А. Метод сравнительного анализа результатов изучения количественных признаков образцов, выращенных в различные годы (метод приведенных средних) // Труды по прикладной ботанике, генетике и селекции. – 2011. – Т. 167. – С. 36–40. [Brutch NB, Porokhovinova EA. Method of comparative analysis used to access the results of evaluating quantitative characters of plant accessions grown in different years (method of reduced average values). Proceedings of applied botany, genetics and breeding. 2011;167:36-40. (In Russ.)]
  19. StatSoft, Inc. (2013) Electronic Statistics Textbook. Tulsa, OK: StatSoft. Available at: http://www.statsoft.com/textbook/. Accessed November 14, 2018.
  20. Наследов А.Д. Математические методы психологического исследования. Анализ и интерпретация данных. – СПб.: Речь, 2012. – 392 с. [Nasledov AD. Matematicheskiye metody psikhologicheskogo issledovaniya. Analiz i interpretatsiya dannykh. St. Petersburg: Rech'; 2012. 392 p. (In Russ.)]
  21. Ивантер Э.В., Коросов А.В. Введение в количественную биологию. – Петрозаводск: Изд-во Петрозаводского ун-та, 2003. – 203 с. [Ivanter EV, Korosov AV. Vvedeniye v kolichestvennuyu biologiyu. Petrozavodsk: Izdatel’stvo Petrozavodskogo universiteta; 2003. 203 p. (In Russ.)]
  22. Ростова Н.С. Корреляции: структура и изменчивость. – СПб.: Изд-во СПбГУ, 2002. – 307 с. [Rostova NS. Korrelyatsii: struktura i izmenchivost'. Saint Petersburg: Izdatel’stvo SPBGU; 2002. 307 p. (In Russ.)]
  23. Злотина М.М., Киселева А.А., Потокина Е.К. Использование аллель-специфичных маркеров генов Vrn и Ppd для экспресс-диагностики фотопериодической чувствительности и потребности в яровизации мягкой пшеницы и ячменя: Методические указания. – СПб.: ВИР, 2012. – 29 с. [Zlotina MM, Kiseleva AA, Potokina EK. Ispol'zovaniye allel'-spetsifichnykh markerov genov Vrn i Ppd dlya ekspress-diagnostiki fotoperiodicheskoi chuvstvitel'nosti i potrebnosti v yarovizatsii myagkoi pshenitsy i yachmenya. Metodicheskie ukazaniya. Saint Petersburg: VIR; 2012. 29 p. (In Russ.)]
  24. Сокорнова С.В., Гасич Е.Л., Бемова В.Д., Матвеева Т.В. Поиск и видовая идентификация патогенов природно-трансгенного вида Linaria vulgaris // Экологическая генетика. – 2018. – Т. 16. – № 1. – С. 27–34. [Sokornova SV, Gasich EL, Bemova VD, Matveeva TV. Characterization and identification of naturally transgenic species Linaria vulgaris pathogenic mycromycetes. Ecological genetics. 2018;16(2):27-34. (In Russ.)]. https://doi.org/10.17816/ecogen16127-34.
  25. Integrated DNA technologies. Available at: https://eu.idtdna.com. Accessed November 14, 2018.
  26. Notredame C, Higgins DG, Heringa J. T-Coffee: a novel method for fast and accurate multiple sequence alignment. J Mol Biol. 2000;302(1):205-217. https://doi.org/10.1006/jmbi.2000.4042.
  27. Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33(7):1870-1874. https://doi.org/10.1093/molbev/msw054.
  28. Okonechnikov K, Golosova O, Fursov M, the UGENE team. Unipro UGENE: a unified bioinformatics toolkit. Bioinformatics. 2012;28(8):1166-1167. https://doi.org/10.1093/bioinformatics/bts091.

Supplementary files

Supplementary Files Action
1. Fig. 1. Pedigree lines of hybrid origin participating in the study View (173KB) Indexing metadata
2. Fig. 2. The proportion of influence (η2) of the degree of linoleness (VL - high-linolenic, SL - srednelenolenovy, NL - low-linolenic) and random variation according to the results of single-factor analysis of variance (ANOVA). * differences between groups are significant; Ho is the total height of the inflorescence; Ht is the technical height of the inflorescence; Inf is the length of the inflorescence; T1 - the duration of the phase of seedlings – flowering of the first flower; T2 - the duration of the flowering phase of the first flower is the ripening of the first box; T3 - the duration of the sprouting phase – ripening of the first box; PAL - palmitic acid; STE - stearic acid; OLE - oleic acid; LIO - linoleic acid; LIN - linolenic acid; IOD - iodine value; F is the Fisher criterion value; p is the probability of similarity of classes (IL, SL, NL); differences - significant differences of these classes according to the results of a posteriori comparison by the Tukey criterion for unequal samples View (271KB) Indexing metadata
3. Fig. 3. Correlation Pleiad signs of plant height, the duration of the vegetation phase phases and the fatty acid composition of seed oil in flax samples, differing in the level of linolenic acid synthesis: a - highly linolenic; b - srednelenolenovye; c - low linolenic. Ho is the total height of the inflorescence; Ht is the technical height of the inflorescence; Inf is the length of the inflorescence; T1 - the duration of the phase of seedlings – flowering of the first flower; T2 - the duration of the flowering phase of the first flower is the ripening of the first box; T3 - the duration of the sprouting phase – ripening of the first box; PAL - palmitic acid; STE - stearic acid; OLE - oleic acid; LIO - linoleic acid; LIN - linolenic acid; IOD - iodine number View (91KB) Indexing metadata
4. Fig. 4. Distribution of 13 studied traits (a) and 40 lines of flax (b) in the system of two factors. Ho is the total height of the inflorescence; Ht is the technical height of the inflorescence; Inf is the length of the inflorescence; T1 - the duration of the phase of seedlings – flowering of the first flower; T2 - the duration of the flowering phase of the first flower is the ripening of the first box; T3 - the duration of the sprouting phase – ripening of the first box; PAL - palmitic acid; STE - stearic acid; OLE - oleic acid; LIO - linoleic acid; LIN - linolenic acid; IOD - iodine number View (140KB) Indexing metadata
5. Fig. 5. Molecular gene labeling of LuFAD3A (a – b) and LuFAD3B (d – e): a, d - restriction map of the gene fragment; c, d — chromatograms of the wild type (rk-2) and mutant (rk-391), SNP are marked by arrows; c, e - electrophoregram of PCR fragment restriction products. VL - high-linolenic, SL - srednelenolevy, NL - low-linolenic View (331KB) Indexing metadata

Views

Abstract - 62

PDF (Russian) - 27

PlumX


Copyright (c) 2019 Porokhovinova E.A., Shelenga T.V., Matveeva T.V., Pavlov A.V., Grigorieva E.A., Brutch N.B.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.