NAT2 and CYP1B1 genetic polymorphisms in patients with genital endometriosis depending on tolerability of melatonin

Full Text

BACKGROUND

External genital endometriosis (EGE) is one of the most pressing problems of modern gynecology, owing to both the high incidence of the disease and the variety of its clinical manifestations such as pain syndrome, infertility, and miscarriage and its recurrent nature. Endometriosis is detected in 70% of female patients visiting a doctor with complaints of pain syndrome and in 35%–50% of infertile patients [1, 2]. To date, there is no universal method that would guarantee complete cure of EGE and full remission. Despite existing methods of combined treatment, endometriosis is characterized by high recurrence rate, which leads to repeated surgical interventions. Along with the surgical removal of foci, pathogenetically grounded hormonal therapy is at the forefront in treatment of the disease [3]. However, the disadvantages of hormone-modulating regimens should also be noted, namely, the impossibility of pregnancy during the treatment with most drugs that have an antigonadotropic effect, the occurrence of serious side effects, and the ineffectiveness of standard treatment regimens in some patients. In this regard, further study of the pathogenesis of endometriosis, search for new drugs with a therapeutic effect on the disease, and description of such effects are important and urgent tasks in modern gynecology.

Melatonin is one of the most promising therapeutic drugs for genital endometriosis. It is an indoleamine-type hormone synthesized from serotonin by secretory cells of the pineal gland through the action of N-acetyltransferase (NAT) and oxindole-O-methyltransferase [4]. Melatonin receptors are present in many organs of the reproductive system, including the mammary glands, myometrium, granulosa cells, etc. [5]. Melatonin is a powerful antioxidant [6, 7] and has antitumor and oncostatic effects. Exogenous administration of this drug leads to a decrease in the incidence of tumors, while pinealectomy stimulates tumor growth [2, 8].

The development of endometriosis is known to be associated with ineffective inflammatory response, oxidative stress, excessive proliferation, neoangiogenesis, and altered production and reception of steroid hormones. Melatonin  exerts its therapeutic effect in endometriosis by neutralizing free radicals that are cytotoxic [6] as well as by suppressing the synthesis of proinflammatory cytokines, changing the production of matrix metalloproteinases, and modeling the processes of angiogenesis [9, 10]. Melatonin is known to reduce the activity of aromatase, increasing the expression of estrogen sulfotransferase, which suggests the antiestrogenic effect of this pineal gland hormone [2]. The therapeutic effect of melatonin was described by T.J. Ness using 10 mg of melatonin administered daily to patients for 8 weeks for the treatment of endometriosis-associated pain [11].

The high efficacy of melatonin, as well as its positive dose-dependent effect on resorption and reduction of endometrioid heterotopias was demonstrated in a study of a model of surgically induced endometriosis in Wistar rats [12]. In clinical practice, melatonin showed a more pronounced positive effect on EGE patients in terms of reducing pain and improving psychoemotional state as part of combination therapy compared with standard hormone-modulating therapy [13].

The data obtained supports the use of melatonin as a promising and effective drug for the treatment of endometriosis. The antigonadotropic effect of melatonin is dose dependent. However, in some patients, this drug causes a number of side effects, such as headache, sleep disturbances in the form of frequent nocturnal awakenings, insomnia, nausea, and pronounced morning sleepiness, which prompt patients to discontinue the course of therapy.

It can be assumed that poor patient tolerance to the drug is associated with a polymorphism in genes encoding enzymes involved in melatonin metabolism.

This work aims to perform a comparative analysis of the polymorphism of some genes encoding enzymes involved in melatonin metabolism.

MATERIALS AND METHODS

DNA samples were obtained from 59 female patients of reproductive age with EGE, established by operative laparoscopy and confirmed through histological examination. The disease was staged according to the revised classification of the American Fertility Society (R-AFS). All patients received melaxen at a dose of 6 mg daily for 2–6 months.

Genomic DNA was extracted from peripheral blood lymphocytes in accordance with the method described in the manual by J. Sambrook et al. with some modifications [14].

Polymorphic variants of genes NAT2 and CYP1B1 were determined by polymerase chain reaction (PCR) with specific oligo primers followed by restriction analysis. For amplification, a programmable thermal cycler from “DNA-Technology” (Moscow) was used. A mixture for amplification with a volume of 25 μL included 15 nM of each primer, 67 mM of Tris-HCl (pH 8.8), 16.6 mM of ammonium sulfate, 6.7 mM of MgCl₂, 6.7 μM of EDTA, 10 mM of mercaptoethanol, 170 μg of BSA, 1.0 mM of each dNTP, and 1 U of DNA polymerase (Bion, Moscow). The primers CYP1B1 F CGTGGGGAGGGACCGTCTGC and CYP1B1 R TCTCCGGGTTAGGCCACTGC were used to amplify the CYP1A1 gene fragment. Primers NAT2 F 5’<GCT GGG TCT GGA AGC TCC TC>3’ and NAT2 R 5’<TTG GGT GAT ACA TAC ACA AGG G>3’ were used to amplify the NAT2 gene fragment.

Table 1 presents the PCR conditions.

 

Table 1. Conditions for the polymerase chain reaction

Gene	Denaturation	Denaturation	Renaturation	Synthesis	Synthesis
	32 cycles
NAT2	94°С — 7 min	94°С — 1 min 10 s	52°С — 1 min 15 s	68°С — 1 min 30 s	72°С — 7 min
CYP1B1	95°С — 4 min	95°С — 40 s	60°С — 40 s	72°С — 40 s	72°С — 5 min

 

Restriction of the amplified DNA fragments was performed in accordance with the manufacturer’s recommendations (Sibenzim).

PCR products were hydrolyzed with a restriction endonuclease (Table 1) at 37°C for 16 h in 10 μl of a reaction mixture containing 5 μl of amplification agent, 3 μl of water, 1 μl × 10 of the buffer recommended by the manufacturer for each restriction endonuclease, and 10 U (0.5 μl) of restriction endonuclease.

Restriction endonucleases and analysis of polymorphic variants of metabolism genes are presented in Table 2.

 

Table 2. Restriction endonucleases and analysis of polymorphic variants of metabolism genes

Gene	Polymorphism	PCR product size	Endonuclease	Allele and size of restriction fragments
CYP1B1	L432V	227 bp	Pst I	I; 208 + 19 bp V; 227 bp
NAT2	C481T	547 bp	Kpn1	S1; 547 bp
	G590A	547 bp	Taq1	S2; 392 + 15 bp
	G857A	547 bp	BamH1	S3; 547 bp

Note: bp — base pairs; PCR — polymerase chain reaction.

 

Completeness of hydrolysis was assessed by the results of electrophoresis in 7.5% polyacrylamide gel (PAAG).

PAAG was stained with an aqueous solution of ethidium bromide (0.5 μg/ml), viewed in ultraviolet light on a Macrovue 50 trans illuminator (Pharmacia LKB, UK), and the image was recorded using a video gel documentation system (Vilber Lourmat).

Results were processed statistically using Microsoft Excel 2002. Significance of the frequency differences was determined using the exact two-tailed Fisher test using the standard formula, taking into account the Yates’ correction for paired comparisons with the control group and using the chi-square test (÷²) with the standard formula as well as the Yates’ correction for paired comparisons and Bonferroni correction for multiple comparisons with the control group.

RESULTS

Polymorphisms of the genes arylamine-NAT 2 (NAT2) and cytochrome P450 1B1 (CYP1B1) were studied. DNA samples were obtained from the peripheral blood lymphocytes of 59 patients with stages I–IV EGE according to the R-AFS classification, confirmed laparoscopically and histologically, who received melatonin therapy at a dose of 6 mg daily for 2–6 months. Melatonin was well tolerated by 64% (n = 38) of patients; 36% (n = 21) had poor tolerance to the drug and its side effects (drowsiness, frequent nocturnal awakenings, headaches, and insomnia), due to which they opted to discontinue the drug.

The product of the gene NAT2 is known to play an important role in acetylation of aromatic and heterocyclic amines and drugs containing aromatic amine groups and to participate in melatonin metabolism.

The homozygous state for the N allele of the NAT2 gene in the group of EGE patients was registered in 6.78% of cases (Table 3).

 

Table 3. Frequency distribution of genotypes and alleles of the NAT2 gene in patients with external genital endometriosis

Genotypes/alleles	External genital endometriosis
	n	%
N/N	4	6.78
S1/N	17	28.8
S2/N	3	5.1
S3/N	1	1.7
S1/S1	12	20.3
S1/S2	11	18.64
S1/S3	–	–
S2/S2	7	11.86
S2/S3	4	6.77
Всего	59	100
Аллели
N	29	24.58
S1	52	44.1
S2	32	27.1
S3	5	4.2

 

The proportion of EGE patients, homo- and heterozygous (genotypes S1/N, S2/N, and S3/N) for the N allele, belonging to the category of “fast” acetylators, was 42.37%. The frequency of the wild-type (N) allele in the group of EGE patients was 24.58%.

In patients with poor tolerance to melatonin, the frequency of the wild-type (N) allele was significantly higher (38.1%) than in patients with good tolerance to the drug (17.1%) (Table 4).

 

Table 4. Frequency distribution of genotypes and alleles of the NAT2 gene depending on melatonin tolerance

Genotypes/alleles	Good tolerance		Poor tolerance		р
	n	%	n	%
N/N	1	2.6	3	14.3	>0.05
S1/N	9	23.7	8	38.1	>0.05
S2/N	1	2.6	2	9.5	>0.05
S3/N	1	2.6	–	–	>0.05
S1/S1	9	23.7	3	14.3	>0.05
S1/S2	10	26.3	1	4.76	>0.05
S1/S3	–	–	–	–	–
S2/S2	5	13.2	2	9.5	>0.05
S2/S3	2	5.3	2	9.5	>0.05
Total	38	100	21	100
Alleles
N	13	17.1	16	38.1	0.02
S1	37	48.7	15	35.7	>0.05
S2	23	30.3	9	21.8	>0.05
S3	3	3.9	2	4.76	>0.05

 

Homo- and heterozygotes for the N allele (fast acetylation phenotype; genotypes N/N, S1/N, S2/N, and S3/N) were registered significantly more frequently in the group of patients with poor drug tolerance compared to the group who had no side effects and whose tolerance to melaxen was good (61.9% and 31.6%, respectively; p = 0.024) (Fig. 1). According to odds ratio (OR), the carriage of the wild-type allele (N) increases the risk of poor melatonin tolerance 3.5-fold (OR = 3.521; confidence interval (CI) = 1.154–10.742).

Cytochrome P450 1B1 (CYP1B1) is a member of the cytochrome P450 gene family and encodes one of the main enzymes involved in estrogen hydroxylation and antioxidant protection (detoxification phase 1 enzyme). This enzyme is involved in the degradation of melatonin. There are several polymorphic variants of the CYP1B1 gene, one of which is the 4326 C/G polymorphism (L432V, rs1056836), associated with a higher catalytic activity compared to the wild-type allele.

 

Fig. 1. Frequency distribution of NAT2 genotypes depending on melatonin tolerance

 

When analyzing the frequency distribution of genotypes and alleles of the CYP1B1 gene, no significant differences were revealed in the subgroups with different degrees of tolerance to melatonin. The polymorphic allele G, associated with increased catalytic activity, with poor drug tolerance was found somewhat more often than that with good tolerance (47.6% and 38.2%, respectively) (Table 5).

 

Table 5. Frequency distribution of genotypes and alleles of the CYP1B1 gene in patients with external genital endometriosis, depending on tolerance to melatonin

Genotypes/alleles	Good tolerance		Poor tolerance
	%	n	%	n
С/С	42.1	16	28.6	6
С/G	39.4	15	47.6	10
G/G	18.4	7	23.8	5
Total	100	38	100	21
Alleles
G	38.2	29	47.6	20
C	61.8	47	52.4	22
Total	100	76	100	42

 

The frequencies of some combined NAT2 and CYP1B1 genotypes, characteristic of different levels of melatonin accumulation in the body, have been analyzed. For the maximum accumulation of melatonin, the genotype corresponding to the phenotype of “fast” acetylation by NAT2 (accumulation of endogenous melatonin) and low catalytic activity of CYP1B1 (slowing down the degradation of both endogenous and exogenous melatonin) are most typical, and for the minimum accumulation, the genotype corresponding to the phenotype of “slow” acetylation by NAT2 (accumulation of endogenous melatonin) and high catalytic activity of CYP1B1 (slowing down the degradation of both endogenous and exogenous melatonin) are most characteristic. A significant increase in the incidence of the N/N(NAT2)+C/C(CYP1B1) genotype corresponding to the phenotype of rapid melatonin accumulation in patients with poor drug tolerance (14% and 0%, respectively; p = 0.04) was revealed (Fig. 2).

 

Fig. 2. Frequencies of combined genotypes for the NAT2 and CYP1B1 genes in patients with different degrees of melatonin tolerance

 

According to the OR coefficient, carriage of the combined genotype N/N(NAT2)+C/C(CYP1B1) increases the risk of poor melatonin tolerance 14-fold (OR = 14.568; CI = 1.002–100.742).

Thus, the study of the NAT2 gene polymorphism revealed that the wild-type (N) allele of the NAT2 gene in EGE patients is associated with poor melatonin tolerability. When analyzing the frequencies of the combined genotypes NAT2 and CYP1B1, it was also found that the phenotype of “fast” acetylation by NAT2 (N/N) in combination with a low catalytic activity of CYP1B1(C/C) was more common in patients with poor melatonin tolerance than in patients who tolerated the therapy well. It can be assumed that the poor tolerance to the drug in individuals with the combined genotype N/N (NAT2) +C/C (CYP1B1) is due to a sufficient level of endogenous melatonin synthesis and insufficiently rapid inactivation of both endogenous and exogenous melatonin.

CONCLUSION

Melatonin can be considered effective both as a component in combination therapy and as monotherapy for EGE patients with pain and infertility. However, the use of melatonin in clinical practice in a number of women as part of combination therapy for EGE is not always possible due to a number of reasons, the main ones being poor drug tolerability and existence of side effects.

Based on the study results, it was established that in EGE patients, the wild-type (N) allele of the NAT2 gene is associated with poor melatonin tolerance. It was also noted that the phenotype of “fast” acetylation by NAT2(N/N) in combination with a low catalytic activity of CYP1B1(C/C) was more common in patients with endometriosis who did not tolerate melatonin well than in those who tolerated the therapy well.

The results obtained substantiate the need to continue research in this field for a deeper understanding of the disease pathogenesis as well as the use of melatonin as targeted therapy. However, in EGE patients with the wild-type (N) allele of the NAT2 gene, administration of melatonin was considered inappropriate due to the occurrence of numerous side effects.

ADDITIONAL INFORMATION

Funding. The research was supported by the Ministry of Science and Higher Education of the Russian Federation within the subject of fundamental scientific research 2019–2021: АААА-А19- 119030490009-6.

Conflict of interest. The authors declare no conflict of interest.

About the authors

Tatyana E. Ivashchenko

Research Institute of Obstetrics, Gynecology and Reproductology named after D.O. Ott

Email: tivashchenko2011@mail.ru
ORCID iD: 0000-0002-8549-6505
Scopus Author ID: 7004724202

Dr. Sci. (Biol.), Professor,  Department of Molecular Medicine

Russian Federation, 3 Mendeleevskaya Line, Saint Petersburg, 199034

Maria I. Yarmolinskaya

Research Institute of Obstetrics, Gynecology and Reproductology named after D.O. Ott; North-Western State Medical University named after I.I. Mechnikov

Email: m.yarmolinskaya@gmail.com
ORCID iD: 0000-0002-6551-4147
SPIN-code: 3686-3605
Scopus Author ID: 7801562649
ResearcherId: P-2183-2014

MD, Dr. Sci. (Med.), Professor, Professor of the Russian Academy of Sciences

Russian Federation, 3 Mendeleevskaya Line, Saint Petersburg, 199034; 41 Kirochnaya Str., Saint Petersburg, 191015

Saimat S. Tkhazaplizheva

Research Institute of Obstetrics, Gynecology and Reproductology named after D.O. Ott

Author for correspondence.
Email: saim86@yandex.ru

MD, Graduate student in the Department of endocrinology of reproduction

Russian Federation, 3 Mendeleevskaya Line, Saint Petersburg, 199034

References

Supplementary files