Molecular epidemiology of malaria vector mosquitoes in coastal areas of Southern Vietnam
- Authors: Luong M.T.1, Romanenko V.A.2, Solovyev A.I.2, Gudkov R.V.2, Kozlov K.V.2, Ovchinnikov D.V.2, Rakin A.I.2, Khalin A.V.3, Aybulatov S.V.3
-
Affiliations:
- Joint Russian-Vietnamese Tropical Research and Technological Center, Southern Branch
- Military Medical Academy
- Zoological Institute of the Russian Academy of Sciences
- Issue: Vol 44, No 4 (2025)
- Pages: 465-473
- Section: Original articles
- Submitted: 24.09.2025
- Accepted: 23.10.2025
- Published: 05.11.2025
- URL: https://journals.eco-vector.com/RMMArep/article/view/691276
- DOI: https://doi.org/10.17816/rmmar691276
- EDN: https://elibrary.ru/YEPPWN
- ID: 691276
Cite item
Abstract
BACKGROUND: This study presents the results of morphological genus-level identification of mosquitoes and molecular-genetic species-level identification of female Anopheles mosquitoes — the primary malaria vectors — collected in the Can Gio Biosphere Reserve, Ho Chi Minh Province. In addition, five species of human malaria parasites of the genus Plasmodium (P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi) were screened in the collected material.
AIM: To assess the species composition of vectors responsible for the most relevant and socially significant vector-borne infections in southern Vietnam during the dry and rainy seasons, and to identify active malaria foci.
METHODS: Arthropod collection was carried out in October 2024 and May 2025 in the Can Gio Biosphere Reserve (Ho Chi Minh Province). Adult hematophagous dipterans were collected using aspirators from hosts, entomological nets from vegetation, as well as from external surfaces of residential and utility buildings. Immature stages were collected by filtering water samples from natural and artificial water bodies suitable for mosquito breeding. Species identification of arthropods was performed based on morphological characteristics using dichotomous keys. Mosquito species identification and Plasmodium detection were conducted using polymerase chain reaction (PCR). Confirmation of Plasmodium ovale was performed by Sanger sequencing.
RESULTS: A total of 414 Anopheles mosquitoes were identified, of which 356 specimens (86%) belonged to An. epiroticus. DNA of Plasmodium parasites was detected in 32 mosquito samples: 17 (53.1%) positive for P. falciparum and 15 (46.9%) for P. ovale.
CONCLUSION: Despite a general decline in malaria incidence in Vietnam, foci of “forest malaria” remain active. In coastal areas of southern Vietnam, An. epiroticus plays an important role in maintaining active malaria transmission. In addition to spreading the causative agent of tropical malaria (P. falciparum), these vectors may also contribute to the transmission of P. ovale, thus sustaining foci of tertian malaria and potentially leading to cases of mixed infections.
Keywords
Full Text
BACKGROUND
Vietnam is located in one of Southeast Asia’s hyperendemic malaria hotspots. Between 2000 and 2010, the country had multiple active foci of tropical, tertian, and quartan malaria. Additionally, cases of malaria caused by Plasmodium knowlesi were reported in the Greater Mekong subregion. Vietnam has made remarkable progress in malaria control over the last decade, with morbidity and mortality rates decreasing year after year. However, malaria is still a major public health concern. This results from persistent active malaria foci, regular transboundary infection transmission caused by seasonal labor migration, resistance of malaria parasites to the main antimalarial drugs, and the widespread distribution of highly effective vectors (Anopheles mosquitoes). Furthermore, research shows that climate change and human activities have altered natural conditions and ecosystems, influencing the distribution, behavior, species composition, and role of various Anopheles species in pathogen transmission. The main malaria vectors, such as An. minimus, An. dirus, An. epiroticus, and An. gigas, change their behavior. Their daily activities shift to early hours and last longer, limiting the effectiveness of measures to safeguard vulnerable populations from their attacks.
Therefore, effective assessment of the infection of bloodsucking arthropods with malaria parasites becomes increasingly relevant. It allows assessment of the risk of infection in time and space, as well as understanding the ecology, geographic distribution, abundance, and behavior of vector species.
Aim
This study aimed to examine the species composition of malaria vectors in the coastal areas of South Vietnam and to assess malaria parasite infection in mosquitoes using morphological analysis and molecular genetic testing.
METHODS
Study Design
The study involved collecting and identifying vectors and assessing their infection with malaria parasites (see Fig. 1).
Fig. 1. Study design.
Vector Collection Sites
The study used adult Anopheles mosquitoes collected from study sites. Vectors were collected from the Can Gio Biosphere Reserve, Ho Chi Minh Province (10°27'17.588'' N 106°53'30.669'' Е), in October 2024 (beginning of the dry season) and May 2025 (beginning of the rainy season) (see Fig. 2).
Fig. 2. The Can Gio Biosphere Reserve, Ho Chi Minh Province, where bloodsucking vectors were collected.
Collection Methods
Vectors were caught using Mosquito-MV-01 traps (SITITEK), with octenol as an attractant, placed in residential areas and near household buildings. Additionally, vectors were collected from host animals using entomological nets (hoop diameter 30 cm) and manual single-chamber exhausters. Vectors were collected at dusk (from 18:00 to 20:00 and from 5:00 to 7:00), and during the dark hours of the day (from 20:00 to 5:00). Vectors were killed using ethyl acetate vapor, fixed, and preserved on cotton pads.
Morphological Identification
Morphological identification of arthropods included several stages. Immediately after collection, specimens were identified only to the genus-level due to limited technological capabilities. Species-level identification was performed in the laboratory using a Leica MZ 6 stereomicroscope. Standard distinctive features were used [1, 2].
Molecular Identification
DNA was extracted for molecular genetic testing using the phenol–chloroform method [3]. For species-level identification of vectors, genetic material samples were taken from one of the legs [4]. Other tests used biological material obtained through the complete disintegration of insects. Molecular genetic identification of vectors was performed using specific primers selected and aligned in MEGA 6.06 based on the known sequences of the 18S rRNA gene of Anopheles from the NCBI database (see Table 1).
Table 1. Primers and probes used in this study for identifying arthropods
Primers | Sequence | Length, bp | Amplicon, bp |
An. minimus | F: TTATTGTACCTTGTGTATCAG | 14 | 51 |
R: GCTCATCCCTTAAAATATTAC | 14 | ||
An. dirus | F: AAAATTTAATTTATTGTCCCTTGG | 18 | 55 |
R: GCTCATCCCTTAAAATATAATTTT | 18 | ||
An. epiroticus | F: GTTTATTTATTTTATTAAATTAATTGACC | 25 | 61 |
R: CTTCATTAAAACCTTTCAAATTAAC | 20 | ||
An. gigas | F: ATAGTAGAAAATGGAGCTGGG | 21 | 55 |
R: GTGTATCAACGTCTATCCCG | 20 | ||
Anopheles spp. | F: GAATGGTTGAATGAGATATATACT | 24 | 57 |
R: CTTTTTTATCGATATGAACTCTCT | 24 | ||
Culex spp. | F: AATAAAAAATTTTATTGGGGTGA | 23 | 51 |
R: TTTTTGTCGATATGAACTCTAA | 22 | ||
Aedes spp. | F: TGGTTGAATGAGATATATACTGTC | 24 | 59 |
R: CAAATATTCATATATTAATGTAAATAAATAA | 31 |
Protozoa (Plasmodium. falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, and Plasmodium knowlesi) were identified by real-time polymerase chain reaction (RT-PCR) using specific primers and probes, which were selected in BLAST NCBI based on the known sequences of the 18S rRNA gene of Plasmodium (see Table 2).
Table 2. Primers and probes used in this study for for identifying malaria parasites
Species/genus | Primer/probe | Sequence |
Plasmodium spp. | PlsmU | F: GTTAAGGGAGTGAAGACGATCAGATA |
PlsmU | R: AAAGACTTTGATTTCTCATAAGG | |
P. falciparum | Fal | F: CCGACTAGGTGTTGGATGAATATAAAAA |
P. knowlesi | Kno | F: CCGACTAGGCTTTGGATGAAAGATTTTA |
P. vivax | Viv | F: CCGACTAGGTTTTGGATGAAAGTTAAAC |
P. ovale | Ova | F: CCAACTAGGTTTTGGATGAAAAGTTTTT |
P. malariae | Mal | F: CCGACTAGGTGTTGGATGATAGAGTAAA |
P. spp. | MP R | R: CAGAACCCAAAGACTTTGATTTCTC |
P. falciparum | MP fal | ROX–GCATTTCTTAGGGAATGTTGA–BHQ2 |
P. knowlesi | MP kno | HEX–GAGTTTTTCTTTTCTCTCCGGAG–BHQ2 |
P. vivax | MP viv | Cy5–GGATAGTCTCTTCGGGGATAGTCC–BHQ2 |
P. ovale | MP ova | FAM–AGAAAATTCCTTTTGGAAATT–BHQ1 |
P. malariae | MP mal | JOE–GAGACATTCATATATATGAGTGTTTC–BHQ1 |
Experts from Evrogen performed targeted Sanger sequencing of P. ovale PCR fragments using a 3500×L analyzer (Applied Biosystems). Phylogenetic and molecular evolutionary analyses were performed using MEGA v.6.
RESULTS
The genus-level identification of the collected arthropods showed that potential malaria parasite vectors (Anopheles mosquitoes) accounted for 46% of the overall bloodsucking mosquito community in South Vietnam’s coastal areas. Mosquitoes of the genera Culex and Aedes account for approximately 35.5% and 3.4%, respectively. Among the collected arthropods, 14.8% were medically insignificant (not transmitting infectious agents), with mosquitoes of the genus Armigeres being the most prevalent (see Table 3).
Table 3. Genus-level identification of medically significant vectors
Collection | Total | Anopheles | Culex | Aedes | Other | ||||
abs. | % | abs. | % | abs. | % | abs. | % | ||
November | 355 | 257 | 39.2 | 365 | 55.7 | 3 | 0.5 | 30 | 4.6 |
May | 251 | 157 | 62.5 | 62 | 24.7 | 9 | 3.6 | 23 | 9.2 |
Total | 606 | 414 | 68.3 | 127 | 21.0 | 12 | 2.0 | 53 | 8.7 |
These findings indicate that the prevalence of malaria parasite vectors among bloodsucking mosquitoes exhibited seasonal patterns. Among the vectors collected in November 2024, Anopheles mosquitoes accounted for 39%, whereas Culex and Aedes mosquitoes accounted for 55.7% and 0.5% of cases, respectively. Among the vectors collected in May 2025, Anopheles mosquitoes were more prevalent than Culex and Aedes (62.5% vs. 24.7% and 3.6%, respectively).
During the species-level identification of malaria parasite vectors, 20 out of 166 (12.0%) specimens were identified as An. epiroticus (see Fig. 3).
Fig. 3. Morphological traits of Anopheles epiroticus (Pyretophorus group): a, wing, ASP on vein R1; b, maxillary palpus; c, segments VI, VII, and reproductive organs; d, proepisternal setae; e, tarsomeres and light-colored scales on the tibia.
Morphological traits of An. gigas occurred in 9 out of 166 (5%) specimens. Distinctive features included venation, structure and shape of maxillary palps, tarsomeres, reproductive organs, and proepisternal setae, and characteristic scales on the tibia (see Fig. 4).
Fig. 4. Morphological traits of Anopheles gigas (Gigas group): a, wing, veins С and R-R1; b, posterior femur; c, PSP and HP on vein C; d, wing edge; e, vein А1.
Mosquitoes identified as An. epiroticus and An. gigas based on morphological traits were further identified by PCR using specific primers. There was perfect agreement between morphological and molecular genetic identification of arthropods. This enabled molecular genetic identification of other collected samples that had lost their characteristic morphological traits due to damage sustained during sample collection, transportation, and storage. Table 4 summarizes the results of species-level identification of mosquitoes.
Table 4. Anopheles species composition
Collection | Total | An. epiroticus | An. gigas | Not differentiated | |||
abs. | % | abs. | % | abs. | % | ||
November | 257 | 213 | 82.9 | 31 | 12.1 | 13 | 5.1 |
May | 157 | 143 | 91.1 | 10 | 6.4 | 4 | 2.5 |
Total | 414 | 356 | 86.0 | 21 | 5.1 | 17 | 4.1 |
Overall, 91.1% of the specimens were identified, with An. epiroticus (86%) and An. gigas (5.1%) being the most prevalent. Species-level identification failed in 17 (4.1%) samples. This was most likely due to small amounts of DNA extracted from these samples. Therefore, samples with total DNA levels of 50 ng/μL or higher were used for subsequent detection of malaria parasite markers.
Samples from 151 insects, including An. epiroticus (142 individuals) and An. gigas (9 individuals), were tested for presence of genetic markers of malaria parasites. All An. gigas samples were negative, indicating the absence of malaria parasites in the vector. In An. epiroticus, 32 (21.2%) samples were positive for Plasmodium spp. markers. Among the mosquitoes caught at the beginning of the dry season (November 2024), 8 (9.7%) were infected. Among the mosquitoes caught during the rainy season (May 2025), genetic markers of malaria parasites were detected in 24 (34.7%) samples (see Table 5).
Table 5. Infection in Anopheles epiroticus mosquitoes
Collection | Total samples | Plasmodium spp. | |
abs. | % | ||
November | 82 | 8 | 9.7 |
May | 143 | 24 | 34.7 |
Total | 151 | 32 | 21.2 |
The analysis of species composition of malaria parasites detected genetic markers of tropical malaria pathogens in 17 (53.1%) cases. PCR detected P. ovale genome markers in 15 (36.9%) samples (see Table 6).
Table 6. Plasmodium species composition
Collection | Total samples | Plasmodium spp. | P. falciparum | P. ovale | |||
abs. | % | abs. | % | abs. | % | ||
November | 82 | 8 | 9.8 | 2 | 25.0 | 6 | 75.0 |
May | 143 | 24 | 34.7 | 15 | 62.5 | 9 | 37.5 |
Total | 151 | 32 | 21.2 | 17 | 53.1 | 15 | 46.9 |
As there are few reported cases of malaria caused by P. ovale in Vietnam, additional tests were performed to confirm these findings. Targeted sequencing of biological material samples from two An. epiroticus species was conducted. Amplification of the nucleotide sequence that included species-specific P. ovale markers was performed using Plasmodium spp. genus-specific primers. The resulting 313-bp sequence was compared with sequences of malaria parasite genomes from GenBank NCBI (see Table 7).
Table 7. Comparison of the obtained sequence with sequences from GenBank (NCBI)
Plasmodium | Number of matches in NCBI | Mean length of matching fragments | Proportion of matches, % | Total score | Expected value |
Falciparum | 76 | 50.33 | 83.82 | 50.24 | 0.013 |
Vivax | 1 | 0 | 87.5 | 41.00 | 0.006 |
Ovale | 713 (100) | 59.52 | 84.3 | 72.38 | 0.002 |
Malariae | 46 | 50.21 | 81.2 | 54.63 | 0.020 |
Knowlesi | 100 (7699) | 47 | 83.8 | 37.52 | 0.020 |
The lowest E-value (expected value) indicates that the similarity between the obtained sequence and the P. ovale sequence from the database was not accidental, but was most likely explained by an actual biological relationship. MEGA v.6 was used for phylogenetic and molecular evolutionary analyses of the obtained sequence. The bootstrap value for 1000 replicates was >50%. The analysis included four sequences of type strains from GenBank NCBI (see Fig. 5).
Fig. 5. Phylogenetic tree constructed by comparing partial nucleotide sequences of the 18s rRNA gene of the examined sequence, obtained from a female Anopheles mosquito sample, with partial 18s rRNA sequences of five species of human malaria parasites, using the maximum likelihood method.
These findings confirmed that An. epiroticus mosquitoes serve as malaria parasite vectors in the coastal areas of South Vietnam. The level of infection in bloodsucking arthropods differed between phases of the malaria season. Plasmodium ovale was detected in total DNA samples from An. epiroticus mosquitoes collected in the Can Gio Mangrove Biosphere Reserve (Ho Chi Minh Province, South Vietnam).
DISCUSSION
In Vietnam, three mosquito species of the genus Anopheles (An. dirus Peyton and Harrison, An. minimus Theobald, and An. epiroticus Linton and Harbach [Sundaicus complex]) constitute the main malaria vectors [7, 8]. These bloodsucking arthropods maintain the foci of tertian malaria. The following species play a role in infection transmission: An. aconitus Dönitz, An. campestris Linnaeus, An. culicifacies Giles, An. indefinitus Ludlow, An. interruptus Puri, An. jeyporiensis James, An. maculatus Theobald, An. lesteri Baisas and Hu, An. nimpe Nguyen, Tran and Harbach, An. sinensis Wiedemann, An. subpictus Grassi, and An. vagus Dönitz. These species spread malaria beyond woodlands.
Among the three main malaria vectors, the An. minimus complex, comprising An. minimus Theobald (previously An. minimus A) and An. harrisoni Harbach and Manguin (previously An. minimus C) [10], is widespread in hilly woodlands. Anopheles dirus and An. minimus mosquitoes breed in small, slow-moving streams with aquatic vegetation and clear water, in broad sunshine [11]. Anopheles dirus primarily occurs in the woodlands of Central and South Vietnam, with a negligible presence in the country’s northern regions. Anopheles epiroticus (previously An. sundaicus species A) is a less prevalent species. These insects breed in warm, stagnant, slightly brackish water and are restricted to South Vietnam’s coastal areas [11].
Numerous studies have confirmed the role of An. dirus and An. minimus in the active transmission of P. knowlesi, P. falciparum, and P. vivax [12]. However, there have been few studies on the occurrence of malaria parasites in An. epiroticus. We found no reports indicating which mosquito species transmit P. ovale.
Out of the four Plasmodium species known as true human parasites, P. falciparum (64%) and P. vivax (35%) are the most prevalent in Vietnam [5]. Plasmodium ovale and P. malariae are substantially less common [5]. A fifth parasite species, P. knowlesi, which affects macaques, was discovered in 2009. This pathogen caused malaria for the first time in a 9-year-old child in Khanh Phu (Khanh Hoa Province, Vietnam) [6].
The distribution of P. ovale is currently thought to be limited to West Africa, the Philippines, East Indonesia, and Papua New Guinea. However, cases of malaria caused by P. ovale have been reported in Bangladesh, Cambodia, India, Thailand, and Vietnam. Prevalence of P. ovale is low (<5%), except in West Africa, where it accounts for more than 10% of malaria cases. Given that the most recent global map of the distribution of this parasite was compiled in 1969, further research into its epidemiology is necessary. Between January 1966 and March 1969, four cases of malaria caused by P. ovale were reported in US military personnel stationed in Vietnam [13]. These reports confirm the (sometimes disputed) presence of this plasmodium in continental Southeast Asia.
Therefore, our findings are consistent with those of recent previous studies. These findings have enhanced our understanding of occurrence of malaria parasites in bloodsucking vectors in the coastal areas of South Vietnam and Southeast Asia.
CONCLUSION
Despite the low incidence of malaria, there are still individual foci of this infection in Vietnam. In the coastal areas of South Vietnam, An. epiroticus play a significant role in maintaining active malaria foci. Apart from transmitting tropical malaria (P. falciparum), these vectors may also transmit P. ovale, maintaining tertian malaria foci and contributing to mixed infections. These findings indicate that further research is necessary, and malaria control strategies must be improved.
The obtained 18S rRNA sequences of the identified P. ovale strains were added to GenBank (NCBI) under BioProject PRJNA1284194.
ADDITIONAL INFO
Author contributions: All authors made a substantial contribution to the conception of the study, acquisition, analysis, interpretation of data for the work, drafting and revising the article, final approval of the version to be published and agree to be accountable for all aspects of the study.
Funding sources: The research and analytical work was carried out using material resources provided within the framework of the scientific research project “Study of the Phase (Seasonal) Transformations of Virulence and Resistance of Plasmodium falciparum in the Organism of Anopheles Mosquito Vectors”, code — “Ekolan M-1.2”.
Statement of originality: This is an original work (based on newly collected data).
Data availability statement: The authors provide limited access to the data (upon request).
Generative AI: Generative AI technologies were not used for this article creation.
Consent for publication: Written consent was obtained from the patients for publication of relevant medical information within the manuscript.
About the authors
Mo Thi Luong
Joint Russian-Vietnamese Tropical Research and Technological Center, Southern Branch
Email: vmeda-nio@mil.ru
ORCID iD: 0000-0002-6035-5933
SPIN-code: 3460-3083
Cand. Sci. (Chemistry)
Viet Nam, Ho Chi Minh CityVladimir A. Romanenko
Military Medical Academy
Author for correspondence.
Email: vmeda-nio@mil.ru
ORCID iD: 0000-0001-5900-9008
SPIN-code: 9855-9483
Lecturer
Russian Federation, Saint PetersburgAleksei I. Solovyev
Military Medical Academy
Email: vmeda-nio@mil.ru
ORCID iD: 0000-0002-3731-1756
SPIN-code: 2502-8831
MD, Dr. Sci. (Medicine), Associate Professor
Russian Federation, Saint PetersburgRoman V. Gudkov
Military Medical Academy
Email: vmeda-nio@mil.ru
ORCID iD: 0000-0001-5498-0479
SPIN-code: 8311-6296
MD, Cand. Sci. (Medicine), Associate Professor
Russian Federation, Saint PetersburgKonstantin V. Kozlov
Military Medical Academy
Email: vmeda-nio@mil.ru
ORCID iD: 0000-0002-4398-7525
SPIN-code: 7927-9076
MD, Dr. Sci. (Medicine), Professor
Russian Federation, Saint PetersburgDmitrii V. Ovchinnikov
Military Medical Academy
Email: vmeda-nio@mil.ru
ORCID iD: 0000-0001-8408-5301
SPIN-code: 5437-3457
MD, Cand. Sci. (Medicine), Associate Professor
Russian Federation, Saint PetersburgAleksandr I. Rakin
Military Medical Academy
Email: vmeda-nio@mil.ru
ORCID iD: 0000-0001-9085-1287
SPIN-code: 2511-4127
Senior Lecturer
Russian Federation, Saint PetersburgAlexey V. Khalin
Zoological Institute of the Russian Academy of Sciences
Email: hallisimo@yandex.ru
ORCID iD: 0000-0002-0662-8857
SPIN-code: 4751-1120
Cand. Sci. (Biology)
Russian Federation, Saint PetersburgSergey V. Aybulatov
Zoological Institute of the Russian Academy of Sciences
Email: Sergei.Aibulatov@zin.ru
ORCID iD: 0000-0002-0699-1701
SPIN-code: 6765-3577
Cand. Sci. (Biology)
Russian Federation, Saint PetersburgReferences
- Stone A. Preliminary keys to the mosquitoes of Vietnam. South East Asia Mosquito Project, Department of Entomology, Smithsonian Institution, US National Museum, 1966. 92 p.
- Panthusiri P, Harrison BA, Harbach RE, et al. Illustrated keys to the mosquitoes of Thailand IV. Anopheles. Southeast Asian J Trop Med Public Health. 2006;37 Suppl 2:1–128. PMID: 17262930
- Guha P, Das A, Dutta S, Chaudhuri TK. Rapid and efficient protocol for DNA extraction from fresh and frozen human blood samples. J Clin Lab Anal. 2018;32(1):e22181. doi: 10.1002/jcla.22181
- Gilbert MT, Moore W, Melchior L, Worobey M. DNA extraction from dry museum beetles without conferring external morphological damage. PLoS One. 2007;2(3):e272. doi: 10.1371/journal.pone.0000272
- Van Long B, Allen G, Brauny M, et al. Molecular surveillance and temporal monitoring of malaria parasites in focal Vietnamese provinces. Malar J. 2020;19(1):458. doi: 10.1186/s12936-020-03561-6
- Van den Eede P, Van HN, Van Overmeir C, et al. Human Plasmodium knowlesi infections in young children in central Vietnam. Malar J. 2009;8:249. doi: 10.1186/1475-2875-8-249
- Obsomer V, Defourny P, Coosemans M. Anopheles species associations in Southeast Asia: indicator species and environmental influences. Parasit Vectors. 2013;6:136. doi: 10.1186/1756-3305-6-136
- Huynh LN, Tran LB, Nguyen HS, et al. Mosquitoes and Mosquito-Borne Diseases in Vietnam. Insects. 2022;13(12):1076. doi: 10.3390/insects13121076
- Ngo CT, Dubois G, Sinou V, et al. Diversity of Anopheles mosquitoes in Binh Phuoc and Dak Nong Provinces of Vietnam and their relation to disease. Parasit Vectors. 2014;7:316. doi: 10.1186/1756-3305-7-316
- Garros C, Nguyen CV, Trung HD, et al. Distribution of Anopheles in Vietnam, with particular attention to malaria vectors of the Anopheles minimus complex. Malar J. 2008;7:11. doi: 10.1186/1475-2875-7-11
- Huynh LN, Tran LB, Nguyen HS, et al. Mosquitoes and mosquito-borne diseases in Vietnam. Insects. 2022;13(12):1076. doi: 10.3390/insects13121076
- Marchand RP, Culleton R, Maeno Y, et al. Co-infections of Plasmodium knowlesi, P. falciparum, and P. vivax among Humans and Anopheles dirus Mosquitoes, Southern Vietnam. Emerg Infect Dis. 2011;17(7):1232–1239. doi: 10.3201/eid1707.101551
- Gleason NN, Fisher GU, Blumhardt R, et al. Plasmodium ovale malaria acquired in Viet-Nam. Bull World Health Organ. 1970;42(3):399–403. PMID: 4392940
- Thanh PV, Van Hong N, Van Van N, et al. Epidemiology of forest malaria in Central Vietnam: the hidden parasite reservoir. Malar J. 2015;14:86. doi: 10.1186/s12936-015-0601-y
- Maude RJ, Ngo TD, Tran DT, et al. Risk factors for malaria in high incidence areas of Viet Nam: a case-control study. Malar J. 2021;20(1):373. doi: 10.1186/s12936-021-03908-7
- World Health Organization (WHO). Guidelines for malaria. Geneva: World Health Organization; 2022.
- Sanh NH, Van Dung N, Thanh NX, et al. Forest malaria in central Vietnam. Am J Trop Med Hyg. 2008;79(5):652–654. PMID: 18981498
- Hung le Q, Vries PJ, Giao PT, et al. Control of malaria: a successful experience from Viet Nam. Bull World Health Organ. 2002;80(8):660–666. PMID: 12219158
- Maeno Y. Molecular epidemiology of mosquitoes for the transmission of forest malaria in south-central Vietnam. Trop Med Health. 2017;45:27. doi: 10.1186/s41182-017-0065-6
- Gleason NN, Fisher GU, Blumhardt R, et al. Plasmodium ovale malaria acquired in Viet-Nam. Bull World Health Organ. 1970;42(3):399–403. PMID: 4392940
- Tamura K, Stecher G, Peterson D, et al. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol. 2013;30(12):2725–2729. doi: 10.1093/molbev/mst197
Supplementary files







