Prevalence of the CCR5 delta32 mutation in the tundra Nenets of Yamal

Full Text

Open Access Open Access
Restricted Access Access granted
Restricted Access Subscription Access

Abstract

CCR5 delta 32 is a genetic variant of CCR5 - deletion mutation of a gene that has a specific impact on the adhesive function of T cells. It is believed that this mutation arose approximately two and a half thousand years ago and eventually spread in Europe. It has been hypothesized that this allele was favored by natural selection during the Black Death. In the heterozygotes, this mutation strongly reduces the chance of HIV infection In the homozygotes, it completely protects against HIV infection. CCR5 delta32 mutation in the heterozygous state occurs in Europe with a frequency of 5-14 %. The incidence of CCR5 delta32 outside of Europe is very low, and in many non-European ethnic groups it is completely absent. The prevalence of this mutation in the population of the Nenets has not previously investigated. It was assumed to have a lower frequency than in Europeans. We carried out an investigation with 54 blood samples of Nenets living in Yamalo-Nenets Autonomous District. DNA was extracted with was QIAamp DNA Mini Kit (QIAGEN) according to the manufacturer protocol. To identify the CCR5 delta32 deletion polymerase chain reaction was conducted using primers: CCR5-D32-F: 5`CTTCATTACACCTGCAGTC3`, CCR5-D32-R: 5`TGAAGATAAGCCTCACAGCC3` under the following conditions: 95˚-5’x1; 95˚-15” → 55˚-15” → 72˚-60”x40; 72˚-10’x1 → 4˚-∞. Products of the reaction were separated in 2 % aga-rose gel for 1.5 hours. Gel documentation was performed using a Gel Doc XR Plus (Bio-Rad, USA). The prevalence of CCR5 delta32 mutation in Nenets was found to be 9.3 %. This was a higher than expected frequency, and it corresponds to the average prevalence of CCR5 delta32 mutation in Europe. Our finding suggests possible European origin of the Nenets.

Full Text

Restricted Access

About the authors

Tatyana Ammosova

Howard University

Email: tatiana.ammosova@howard.edu
PhD, Assistant Research Professor, Howard University, College of Medicine

Andrey Sergeyevich Egorov

Saint Petersburg State Pediatric Medical University

Email: egorov.doc@gmail.com
MD, Research Fellow, Chair of Hospital Pediatrics

Elena Vladimirovna Fedorova

Saint Petersburg State Pediatric Medical University

Email: detymedic@mail.ru
MD, Research Fellow, Chair of Hospital Pediatrics

Sergey Lvovich Avrusin

Saint Petersburg State Pediatric Medical University

Email: avrusin4@gmail.com
MD, PhD, Associate Professor, Chair of Hospital Pediatrics

Andrey Vyacheslavovich Santimov

Saint Petersburg State Pediatric Medical University

Email: a.santimoff@gmail.com
MD, Research Fellow, Chair of Hospital Pediatrics

Sergei Nekhai

Howard University

Email: snekhai@howard.edu
Ph.D., Director, RCMI Proteomics Core Facility, Associate Professor, Center for Sickle Cell Disease. Howard University, College of Medicine

References

  1. Kofiadi I. A. Geneticheskaya ustoychivost' k zarazheniyu VICh i razvitiyu SPID v populyatsiyakh Rossii i sopredel'nykh gosudarstv [Genetic resistance to HIV infection and development of AIDS in populations of Russia and neighboring countries]. Avtoref. dis. na soisk. uch. st. kand. biol. nauk. M.; 2008. Available from: http://www.dna-technology.ru/files/images/d/0b136b567d25d4be1dfa26a8b39ec2b9.pdf (accessed 18.09.2014).
  2. Nikolaeva I. A., Maksimova N. R., Nikolaeva T. Ya., Puzyrev V. P. Deletsionnyy polimorfizm gena retseptora khemokina 5 i risk razvitiya rasseyannogo skleroza v Yakutii [Deletion polymorphism in the gene for the receptor of the chemokine 5 and the risk of developing multiple sclerosis in Yakutia]. Yakutskiy meditsinskiy zhurnal. 2007; 2 (18): 10-12.
  3. Ghorban K., Dadmanesh M., Hassanshahi G., Momeni M., Zare-Bidaki M., Arababadi M. K., Kennedy D. Is the CCR5 Δ 32 mutation associated with immune system-related diseases? Inflammation. 2013; 36 (3): 633-42.
  4. Hinks A., Martin P., Flynn E., Eyre S., Packham J. Childhood Arthritis Prospective Study (CAPS), UKRAG Consortium, BSPAR Study Group, Barton A., Worthington J., Thomson W. Association of the CCR5 gene with juvenile idiopathic arthritis. Genes Immun. 2010; 11 (7): 584-89.
  5. Lee Y. H., Kim J. H., Song G. G. Chemokine receptor 5 Δ32 polymorphism and systemic lupus erythematosus, vasculitis, and primary Sjogren's syndrome: Meta-analysis of possible associations. Z Rheumatol. 2014; Mar 7. Available from: http://link.springer.com/article/10.1007 %2Fs00393-014-1356-5 (accessed 18.09.2014).
  6. Limborska S. A., Balanovsky O. P., Balanovskaya E. V., Slominsky P. A., Schadrina M. I., Livshits L. A., Kravchenko S. A., Pampuha V. M., Khusnutdinova E. K., Spitsyn V. A. Analysis of CCR5Delta32 geographic distribution and its correlation with some climatic and geographic factors. Hum Hered. 2002; 53 (1): 49-54.
  7. Lucotte G., Mercier G. Distribution of the CCR5 gene 32-bp deletion in Europe. J Acquir Immune Defic Syndr Hum Retrovirol. 1998; 19 (2): 174-77.
  8. Novembre J., Galvani A. P., Slatkin M. The Geographic Spread of the CCR5 Δ32 HIV-Resistance Allele PLoS Biol. 2005; 3 (11): e339.
  9. Sabeti P. C., Walsh E., Schaffner S. F., Varilly P., Fry B., Hutcheson H. B., Cullen M., Mikkelsen T. S., Roy J., Patterson N., Cooper R., Reich D., Altshuler D., O'Brien S., Lander E. S. The case for selection at CCR5-Delta32. PLoS Biol. 2005; 3 (11): e378.
  10. Song G. G., Kim J. H., Lee Y. H. The chemokine receptor 5 delta32 polymorphism and type 1 diabetes, Behcet's disease, and asthma: a meta-analysis. Immunol Invest. 2014; 43 (2): 123-36.
  11. Stephens J. C., Reich D. E., Goldstein D. B., Shin H. D., Smith M. W., Carrington M., Winkler C., Huttley G. A., Allikmets R., Schriml L., Gerrard B., Malasky M., Ramos M. D., Morlot S., Tzetis M., Oddoux C., di Giovine F. S., Nasioulas G., Chandler D., Aseev M., Hanson M., Kalaydjieva L., Glavac D., Gasparini P., Kanavakis E., Claustres M., Kambouris M., Ostrer H., Duff G., Baranov V., Sibul H., Metspalu A., Goldman D., Martin N., Duffy D., Schmidtke J., Estivill X., O'Brien S. J., Dean M. Dating the origin of the CCR5-Delta32 AIDS-resistance allele by the coalescence of haplotypes. Am J Hum Genet. 1998; 62 (6): 1507-1515.
  12. Golovnev A. V., Osherenko G. Siberian survival. Nenets and their story. Cornel Univ. Press; 1999.
  13. Galvany A. P., Slatkin M. Evaluating plague and smallpox as historical selective pressures for the CCR5-delta32 HIV-resistance allele. Proc Natl Acad Sci USA. 2003; 100 (25): 15276-279.
  14. Forsyth J. A history of the peoples of Siberia: Russia's North Asian Colony 1581-1990. Cambridge University Press.; 1992.

Statistics

Views

Abstract: 2309

PDF (Russian): 303

Dimensions

Article Metrics

Metrics Loading ...

PlumX


Copyright (c) 2014 Ammosova T., Egorov A.S., Fedorova E.V., Avrusin S.L., Santimov A.V., Nekhai S.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies